Direkt zum Inhalt
Merck

EHU075951

Sigma-Aldrich

MISSION® esiRNA

targeting human FBXW7

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAGCAGTCACAGGCAAATGTCTGAGAACATTAGTGGGACATACAGGTGGAGTATGGTCATCACAAATGAGAGACAACATCATCATTAGTGGATCTACAGATCGGACACTCAAAGTGTGGAATGCAGAGACTGGAGAATGTATACACACCTTATATGGGCATACTTCCACTGTGCGTTGTATGCATCTTCATGAAAAAAGAGTTGTTAGCGGTTCTCGAGATGCCACTCTTAGGGTTTGGGATATTGAGACAGGCCAGTGTTTACATGTTTTGATGGGTCATGTTGCAGCAGTCCGCTGTGTTCAATATGATGGCAGGAGGGTTGTTAGTGGAGCATATGATTTTATGGTAAAGGTGTGGGATCCAGAGACTGAAACCTGTCTACACACGTTGCAGGGGCATACTAAT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Mariusz L Hartman et al.
Molecular carcinogenesis, 58(4), 588-602 (2018-12-18)
We have extensively studied the phenotypic heterogeneity of patient-derived melanoma cells. Here, whole-exome sequencing revealed novel variants of genes associated with the MAPK, NOTCH, Hippo, cell-cycle, senescence, and ubiquitin-dependent pathways, which could contribute to the observed phenotypic diversity between cell
Hui Wang et al.
Cancer cell international, 20, 258-258 (2020-06-25)
Cisplatin is widely used as a first-line treatment for non-small cell lung cancer (NSCLC), but chemoresistance remains a major clinical obstacle for efficient use. As a microRNA, miR-223 was reported to promote the doxorubicin resistance of NSCLC. However, whether miR-223
Jun Shao et al.
Molecular and cellular endocrinology, 498, 110541-110541 (2019-08-16)
MicroRNAs (miRNAs) are small RNAs without protein-coding functions that negatively regulate target genes and play important roles in physiological and pathological processes. The aim of this work was to reveal a novel miRNA/gene pathway in diabetic retinopathy (DR). A microarray
Veronika Reiterer et al.
The EMBO journal, 36(3), 260-273 (2016-12-23)
The F-box protein FBXW7 is the substrate-recruiting subunit of an SCF ubiquitin ligase and a major tumor-suppressor protein that is altered in several human malignancies. Loss of function of FBXW7 results in the stabilization of numerous proteins that orchestrate cell
Qiang Fu et al.
Aging, 11(24), 11865-11879 (2019-12-28)
Our study aspires to understand the impact of miR-27b on myocardial fibrosis as well as its functional mechanism. 12 days post the ligation of coronary artery in rats, the expression of miR-27b in the peri-infarction region was elevated. Treating cultivated

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.