Direkt zum Inhalt
Merck

EHU075391

Sigma-Aldrich

MISSION® esiRNA

targeting human GREM1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAGCGAGACTGGTGCAAAACCCAGCCGCTTAAGCAGACCATCCACGAGGAAGGCTGCAACAGTCGCACCATCATCAACCGCTTCTGTTACGGCCAGTGCAACTCTTTCTACATCCCCAGGCACATCCGGAAGGAGGAAGGTTCCTTTCAGTCCTGCTCCTTCTGCAAGCCCAAGAAATTCACTACCATGATGGTCACACTCAACTGCCCTGAACTACAGCCACCTACCAAGAAGAAGAGAGTCACACGTGTGAAGCAGTGTCGTTGCATATCCATCGATTTGGATTAAGCCAAATCCAGGTGCACCCAGCATGTCCTAGGAATGCAGCCCCAGGAAGTCCCAGACCTAAAACAACCAGATTCTTACTTGGCTTAAACCTAGAGGCCAGAAGAACCCCCAGCTGCCTCCTGGCAGGAGCCTGCTTGTGCGTAGTTCGTGTGCATGAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Duo Li et al.
Molecular vision, 25, 625-635 (2019-11-09)
To investigate the role of Gremlin-1, which is an endogenous antagonist of the bone morphogenetic protein (BMP) signaling pathway, in inducing epithelium-mesenchymal transition (EMT) in fetal RPE cells after repeated wounds. Subconfluent repetitive passages in fetal RPE cells were regarded
Nam Ji Sung et al.
International journal of molecular sciences, 21(23) (2020-12-09)
Gremlin-1 (GREM1), one of the bone morphogenetic protein (BMP) antagonists, can directly bind to BMPs. GREM1 is involved in organogenesis, tissue differentiation, and organ fibrosis. Recently, numerous studies have reported the oncogenic role of GREM1 in cancer. However, the role
Na Hui Kim et al.
Biochemical and biophysical research communications, 533(4), 1378-1384 (2020-10-25)
Gremlin-1 (GREM1), one of the antagonists of bone morphogenetic proteins (BMPs), has recently been reported to be overexpressed in a variety of cancers including breast cancer. GREM1 is involved in tumor promotion, but little is known about its role in
Kongzu Hu et al.
Molecular medicine reports, 15(4), 2186-2194 (2017-03-06)
Previous research focusing on rodent cells and animal models has demonstrated that gremlin-1 antagonizes bone morphogenetic proteins (BMPs) in order to suppress osteogenesis. However, the impact of gremlin‑1 on osteogenesis in human bone marrow-derived mesenchymal stem cells (MSCs) remains unknown.
Julie R Graham et al.
Journal of cellular biochemistry, 115(9), 1539-1548 (2014-03-19)
Fibrosis is a chronic disease characterized by an excessive deposition of scar tissue in the affected organs. A central mediator of this process is transforming growth factor-β (TGF-β), which stimulates the production of extracellular matrix proteins such as collagens. MicroRNAs

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.