Direkt zum Inhalt
Merck

EHU072911

Sigma-Aldrich

MISSION® esiRNA

MISSION® esiRNA

targeting human FOSL2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGCTGGGGATTCAGCTCTAGAGGTCACAGTATCCTCGTTTGAAAGATAATTAAGATCCCCCGTGGAGAAAGCAGTGACACATTCACACAGCTGTTCCCTCGCATGTTATTTCATGAACATGACCTGTTTTCGTGCACTAGACACACAGAGTGGAACAGCCGTATGCTTAAAGTACATGGGCCAGTGGGACTGGAAGTGACCTGTACAAGTGATGCAGAAAGGAGGGTTTCAAAGAAAAAGGATTTTGTTTAAAATACTTTAAAAATGTTATTTCCTGCATCCCTTGGCTGTGATGCCCCTCTCCCGATTTCCCAGGGGCTCTGGGAGGGACCCTTCTAAGAAGATTGGGCAGTTGGGTTTCTGGCTTGAGATGAATCCAAGCAGCAGAATGAGCCAGGAGTAGCAGGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lan Ling et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 104, 411-419 (2018-05-23)
Hepatocyte proliferation and apoptosis are critical cellular behaviors in rat liver as a result of a liver injury. Herein, we performed this study in order to evaluate the role of miR-30e and its target Fos-Related Antigen-2 (FOSL2) in septic rats
Shuo Li et al.
Experimental cell research, 373(1-2), 57-61 (2018-08-17)
Among different cancers, incidence and mortality of colorectal cancer (CRC) is one of the highest. KRAS mutation is one of the underlying features in the pathogenesis of CRC with CRC tumors harboring mutant KRAS exhibiting a more aggressive behavior compared
Poonam Sarode et al.
Science advances, 6(23), eaaz6105-eaaz6105 (2020-06-18)
Tumor-associated macrophages (TAMs) influence lung tumor development by inducing immunosuppression. Transcriptome analysis of TAMs isolated from human lung tumor tissues revealed an up-regulation of the Wnt/β-catenin pathway. These findings were reproduced in a newly developed in vitro "trained" TAM model.
Keito Okazaki et al.
Nature communications, 11(1), 5911-5911 (2020-11-22)
Transcriptional dysregulation, which can be caused by genetic and epigenetic alterations, is a fundamental feature of many cancers. A key cytoprotective transcriptional activator, NRF2, is often aberrantly activated in non-small cell lung cancers (NSCLCs) and supports both aggressive tumorigenesis and
Jon M Carthy et al.
Journal of cellular physiology, 230(12), 3084-3092 (2015-06-23)
Transforming growth factor-β (TGF-β) is a multifunctional cytokine which stimulates the differentiation of fibroblasts into myofibroblasts. Myofibroblasts are critical for normal wound healing, but also accumulate pathologically in a number of chronic inflammatory conditions where they are key contributors to

Questions

Reviews

Active Filters

  1. 1 Ratings-Only Review

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.