Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU072801

Sigma-Aldrich

MISSION® esiRNA

targeting human GIPC1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATCGACCACATCCACCTCATCAGCGTGGGCGACATGATCGAGGCCATTAACGGGCAGAGCCTGCTGGGCTGCCGGCACTACGAGGTGGCCCGGCTGCTCAAGGAGCTGCCCCGAGGCCGTACCTTCACGCTGAAGCTCACGGAGCCTCGCAAGGCCTTCGACATGATCAGCCAGCGTTCAGCGGGTGGCCGCCCTGGCTCTGGCCCACAACTGGGCACTGGCCGAGGGACCCTGCGGCTCCGATCCCGGGGCCCCGCCACGGTGGAGGATCTGCCCTCTGCCTTTGAAGAGAAGGCCATTGAGAAGGTGGATGACCTGCTGGAGAGTTACATGGGTATCAGGGACACGGAGCTGGCGGCCACCATGGTGGAGCTGGGAAAGGACAAAAGGAACCCGGATGAGCTGGCCGAGGCCCTGGACGAACGGCTGGGTGACTTTGCCTTCCCTGAC

Ensembl | Human Hinterlegungsnummer

ENSG00000123159

NCBI-Hinterlegungsnummer

NM_005716

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... GIPC1(10755) , GIPC1(10755)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Guilong Zhang et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13777-13788 (2016-08-03)
Glioma occurs due to multi-gene abnormalities. Neuropilin-1 (NRP-1), as a transmembrane protein, involves in glioma proliferation, invasion, and migration, as well as tumor angiogenesis. The cytoplasmic protein, GAIP/RGS19-interacting protein (GIPC1), could regulate the clathrin-vesicles trafficking and recycling. Here, we show
Ling Wang et al.
PloS one, 2(11), e1161-e1161 (2007-11-15)
Vascular permeability factor/vascular endothelial growth factor (VPF/VEGF), one of the crucial pro-angiogenic factors, functions as a potent inhibitor of endothelial cell (EC) apoptosis. Previous progress has been made towards delineating the VPF/VEGF survival signaling downstream of the activation of VEGFR-2.
Xiuping Huang et al.
Nature communications, 10(1), 3708-3708 (2019-08-20)
Neuropilin-1 (NRP1) is an essential transmembrane receptor with a variety of cellular functions. Here, we identify two human NRP1 splice variants resulting from the skipping of exon 4 and 5, respectively, in colorectal cancer (CRC). Both NRP1 variants exhibit increased
Ayumi Yoshida et al.
Biology open, 4(9), 1063-1076 (2015-07-26)
Neuropilin-1 (NRP1) has been identified as a VEGF-A receptor. DJM-1, a human skin cancer cell line, expresses endogenous VEGF-A and NRP1. In the present study, the RNA interference of VEGF-A or NRP1 suppressed DJM-1 cell proliferation. Furthermore, the overexpression of
Santanu Bhattacharya et al.
PloS one, 9(12), e114409-e114409 (2014-12-04)
GAIP interacting protein C terminus (GIPC) is known to play an important role in a variety of physiological and disease states. In the present study, we have identified a novel role for GIPC as a master regulator of autophagy and

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.