Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU070111

Sigma-Aldrich

MISSION® esiRNA

targeting human CCNE1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATCCTCCAAAGTTGCACCAGTTTGCGTATGTGACAGATGGAGCTTGTTCAGGAGATGAAATTCTCACCATGGAATTAATGATTATGAAGGCCCTTAAGTGGCGTTTAAGTCCCCTGACTATTGTGTCCTGGCTGAATGTATACATGCAGGTTGCATATCTAAATGACTTACATGAAGTGCTACTGCCGCAGTATCCCCAGCAAATCTTTATACAGATTGCAGAGCTGTTGGATCTCTGTGTCCTGGATGTTGACTGCCTTGAATTTCCTTATGGTATACTTGCTGCTTCGGCCTTGTATCATTTCTCGTCATCTGAATTGATGCAAAAGGTTTCAGGGTATCAGTGGTGCGACATAGAGAACTGTGTCAAGTGGATGGTTCCATTTGCCATGGTTATAAGGGAGACGGGGA

Ensembl | Human Hinterlegungsnummer

ENSG00000105173

NCBI-Hinterlegungsnummer

NM_001238

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CCNE1(898) , CCNE1(898)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

X Zhang et al.
Neoplasma, 66(5), 704-716 (2019-05-28)
Previous studies have reported that miR-107 could be utilized as a potential peripheral biomarker in prostate cancer (PCa). However, the specific functions of miR-107 in prostate cancer and its relevant mechanisms are still unknown. The aim of this research was
Wei-Wei Liu et al.
Cancer management and research, 13, 439-447 (2021-01-28)
To explore the regulatory role of miR497-5p-CCNE1 axis in triple-negative breast cancer (TNBC) cells and its predictive value for early diagnosis. Cancer tissue and adjacent tissue samples were collected from 86 patients with TNBC.RT-PCR was used to detect the expression
Caishang Zheng et al.
Scientific reports, 7(1), 16422-16422 (2017-11-29)
Enterovirus 71 (EV71) is the predominant causative pathogen of hand-foot-and-mouth disease (HFMD). Contrary to other HFMD-causing enterovirus, EV71 can lead to severe neurological complications, even death. MicroRNAs (miRNAs) are small non-coding RNAs that constitute the largest family of gene regulators
Ran Wei et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 38(9), 1952-1964 (2020-03-13)
While amplified expressed cyclin E1 is a well-known tumorigenic factor and prognostic biomarker in several malignancies, its prognostic predictive potential and function in osteosarcoma is poorly understood. Here we reveal discrete expression pattern, correlation to clinicopathological characteristics and prognosis and
Pilar Alonso-Lecue et al.
Cell death & disease, 8(6), e2901-e2901 (2017-07-01)
Squamous cell carcinoma (SCC) or epidermoid cancer is a frequent and aggressive malignancy. However in apparent paradox it retains the squamous differentiation phenotype except for very dysplastic lesions. We have shown that cell cycle stress in normal epidermal keratinocytes triggers
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.