Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU062641

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCAAAGTCACTTCCCCAAGATCTGCCAGACCTGCATGGTCAAGCCTCTTATGGGGGTGTTTCTATCTCTTTCTTTCTCTTTCTGTTTCCTGGCCTCAGAGCTTCCTGGGGACCAAGATTTACCAATTCACCCACTCCCTTGAAGTTGTGGAGGAGGTGAAAGAAAGGGACCCACCTGCTAGTCGCCCCTCAGAGCATGATGGGAGGTGTGCCAGAAAGTCCCCCCTCGCCCCAAAGTTGCTCACCGACTCACCTGCGCAAGTGCCTGGGATTCTACCGTAATTGCTTTGTGCCTTTGGGCACGGCCCTCCTTCTTTTCCTAACATGCACCTTGCTCCCAATGGTGCTTGGAGGGGGAAGAGATCCCAGGAGGTGCAGTGGAGGGGGCAAGCTTTGCTCCTTCAGTTCTGCTTGCTCC

Ensembl | Human Hinterlegungsnummer

ENSG00000106125

NCBI-Hinterlegungsnummer

NM_000385

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... AQP1(358) , AQP1(358)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hilary S Dorward et al.
Journal of experimental & clinical cancer research : CR, 35, 36-36 (2016-02-26)
Aquaporins (AQP) are water channel proteins that enable fluid fluxes across cell membranes, important for homeostasis of the tissue environment and for cell migration. AQP1 knockout mouse models of human cancers showed marked inhibition of tumor-induced angiogenesis, and in pre-clinical
Laura Simone et al.
Journal of cellular and molecular medicine, 22(2), 904-912 (2017-10-19)
Aquaporin-1 (AQP1) is a proangiogenic water channel protein promoting endothelial cell migration. We previously reported that AQP1 silencing by RNA interference reduces angiogenesis-dependent primary tumour growth in a mouse model of melanoma. In this study, we tested the hypothesis that
Yu-Rong Mu et al.
Journal of inflammation research, 13, 701-712 (2020-10-30)
Previous studies have confirmed that aquaporin 1 (AQP1) is up-regulated in synovium of rheumatoid arthritis (RA), but its exact pathogenic mechanisms in RA are unclear. This study revealed the pathogenic role of AQP1 in rat collagen-induced arthritis (CIA) and the
Qiang Zhang et al.
Journal of receptor and signal transduction research, 39(2), 146-153 (2019-07-18)
To investigate the effect of miR-223 on thyroid cancer cells, further to study its potential mechanisms. The difference in miR-223 expression between normal thyroid Nthy-ori3-l cells and thyroid cancer SW579 cells was detected by PCR. The miR-223 overexpression and silencing
Hui Luo et al.
Cell and tissue research, 381(3), 543-554 (2020-06-17)
To explore the effects of aquaporin (AQP) 1 on pregnancy outcome and the association between expression of AQP1 and other AQPs in the placenta and foetal membranes, the rate of copulatory plugs and pregnancy, amniotic fluid (AF) volume, osmolality and
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.