Direkt zum Inhalt
Merck

EHU058031

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNK2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Voraussichtliches Versanddatum22. Mai 2025



Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Voraussichtliches Versanddatum22. Mai 2025


Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGAAGACGGTCTCCACGATATTCCTGGTGGTTGTCCTCTATCTGATCATCGGAGCCACCGTGTTCAAAGCATTGGAGCAGCCTCATGAGATTTCACAGAGGACCACCATTGTGATCCAGAAGCAAACATTCATATCCCAACATTCCTGTGTCAATTCGACGGAGCTGGATGAACTCATTCAGCAAATAGTGGCAGCAATAAATGCAGGGATTATACCGTTAGGAAACACCTCCAATCAAATCAGTCACTGGGATTTGGGAAGTTCCTTCTTCTTTGCTGGCACTGTTATTACAACCATAGGATTTGGAAACATCTCACCACGCACAGAAGGCGGCAAAATATTCTGTATCATCTATGCCTTACTGGGAATTCCCCTCTTTGGTTTTCTCTTGGCTGGAGTTGGAGATCAGCTAGGCACCATATTTGGAAAAGGAATTGCCAAAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Oleg Yarishkin et al.
Investigative ophthalmology & visual science, 60(6), 2294-2303 (2019-05-23)
The concentration of protons in the aqueous humor (AH) of the vertebrate eye is maintained close to blood pH; however, pathologic conditions and surgery may shift it by orders of magnitude. We investigated whether and how changes in extra- and
Junsung Woo et al.
The Journal of physiology, 598(20), 4555-4572 (2020-07-25)
Neuronal activity causes astrocytic volume change via K+ uptake through TREK-1 containing two-pore domain potassium channels. The volume transient is terminated by Cl- efflux through the Ca2+ -activated anion channel BEST1. The source of the Ca2+ required to open BEST1
Ricardo H Pineda et al.
American journal of physiology. Renal physiology, 313(2), F535-F546 (2017-05-26)
Detrusor overactivity (DO) is the abnormal response of the urinary bladder to physiological stretch during the filling phase of the micturition cycle. The mechanisms of bladder smooth muscle compliance upon the wall stretch are poorly understood. We previously reported that
Haiyun Guo et al.
BMC anesthesiology, 17(1), 124-124 (2017-09-06)
There are growing concerns that anaesthetic exposure can cause extensive apoptotic degeneration of neurons and the impairment of normal synaptic development and remodelling. However, little attention has been paid to exploring the possible cytotoxicity of inhalation anaesthetics, such as isoflurane

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.