Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU054741

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKD1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGCTTCTGAAGGGGCTTTTCAGGCAGGGCTTGCAGTGCAAAGATTGCAGATTCAACTGCCATAAACGTTGTGCACCGAAAGTACCAAACAACTGCCTTGGCGAAGTGACCATTAATGGAGATTTGCTTAGCCCTGGGGCAGAGTCTGATGTGGTCATGGAAGAAGGGAGTGATGACAATGATAGTGAAAGGAACAGTGGGCTCATGGATGATATGGAAGAAGCAATGGTCCAAGATGCAGAGATGGCAATGGCAGAGTGCCAGAACGACAGTGGCGAGATGCAAGATCCAGACCCAGACCACGAGGACGCCAACAGAACCATCAGTCCATCAACAAGCAACAATATCCCACTCATGAGGGTAGTGCAGTCTGTCAAACACACGAAGAGGAAAAGCAGCAC

Ensembl | Human Hinterlegungsnummer

ENSG00000184304

NCBI-Hinterlegungsnummer

NM_002742

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... PRKD1(5587) , PRKD1(5587)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Kimberly A Coughlan et al.
The Journal of biological chemistry, 291(11), 5664-5675 (2016-01-23)
AMP-activated protein kinase (AMPK) is an energy-sensing enzyme whose activity is inhibited in settings of insulin resistance. Exposure to a high glucose concentration has recently been shown to increase phosphorylation of AMPK at Ser(485/491) of its α1/α2 subunit; however, the
Qi Zhou et al.
Archives of toxicology, 93(6), 1639-1648 (2019-04-26)
2,3',4,4',5-Pentachlorobiphenyl (PCB118) has been shown to cause thyroidal ultrastructure lesions, but the underlying mechanism remains elusive. This study aimed to elucidate the mechanism by which PCB118 induces the abnormalities of the thyrocytes. Wistar rats were injected intraperitoneally with PCB118 (0
Di Zhao et al.
International journal of biological sciences, 13(3), 276-285 (2017-04-04)
Growing evidence shows that protein kinase D (PKD) plays an important role in the development of pressure overload-induced cardiac hypertrophy. However, the mechanisms involved are not clear. This study tested our hypothesis that PKD might mediate cardiac hypertrophy by negatively
Jonathan Baker et al.
PloS one, 13(4), e0195864-e0195864 (2018-04-14)
Many catabolic stimuli, including interleukin-1 (IL-1) in combination with oncostatin M (OSM), promote cartilage breakdown via the induction of collagen-degrading collagenases such as matrix metalloproteinase 1 (MMP1) and MMP13 in human articular chondrocytes. Indeed, joint diseases with an inflammatory component
Jia Wang et al.
American journal of physiology. Cell physiology, 310(7), C542-C557 (2016-01-08)
Given the fundamental role of β-catenin signaling in intestinal epithelial cell proliferation and the growth-promoting function of protein kinase D1 (PKD1) in these cells, we hypothesized that PKDs mediate cross talk with β-catenin signaling. The results presented here provide several
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.