Direkt zum Inhalt
Merck

EHU054291

Sigma-Aldrich

MISSION® esiRNA

targeting human NNMT

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGACAAGAAGGGCTGAACTGATGGAAGGAATGCTGTTAGCCTGAGACTCAGGAAGACAACTTCTGCAGGGTCACTCCCTGGCTTCTGGAGGAAAGAGAAGGAGGGCAGTGCTCCAGTGGTACAGAAGTGAGACATAATGGAATCAGGCTTCACCTCCAAGGACACCTATCTAAGCCATTTTAACCCTCGGGATTACCTAGAAAAATATTACAAGTTTGGTTCTAGGCACTCTGCAGAAAGCCAGATTCTTAAGCACCTTCTGAAAAATCTTTTCAAGATATTCTGCCTAGACGGTGTGAAGGGAGACCTGCTGATTGACATCGGCTCTGGCCCCACTATCTATCAGCTCCTCTCTGCTTGTGAATCCTTTAAGGAGATCGTCGTCACTGACTACTCAGACCAGAACCTGCAGGAGCTGGAGAAGTGGCTGAAGAAAGAGCCAGAGGCCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yanzhong Wang et al.
Breast cancer research : BCR, 21(1), 64-64 (2019-05-19)
Nicotinamide N-methyltransferase (NNMT) is overexpressed in various human tumors and involved in the development and progression of several carcinomas. In breast cancer, NNMT was found to be overexpressed in several cell lines. However, the clinical relevance of NNMT in breast
Yanyan Cui et al.
Molecular carcinogenesis, 59(8), 940-954 (2020-05-06)
Esophageal squamous cell carcinoma (ESCC) is a common malignant tumor with poor prognosis. And different individuals respond to the same drug differently. Increasing evidence has confirmed that metabolism reprogramming was involved in the drug sensitivity of tumor cells. However, the
Yanyan Cui et al.
Molecular and cellular biochemistry, 460(1-2), 93-103 (2019-07-07)
Nicotinamide N-methyltransferase (NNMT) is an important methyltransferase involved in the biotransformation of many drugs and exogenous compounds. Abnormal expression of NNMT protein is closely associated with the onset and progression of many malignancies, but little is known about its role
Bashar M Thejer et al.
BMC molecular and cell biology, 21(1), 26-26 (2020-04-16)
Progesterone receptor membrane component 1 (PGRMC1) is often elevated in cancers, and exists in alternative states of phosphorylation. A motif centered on PGRMC1 Y180 was evolutionarily acquired concurrently with the embryological gastrulation organizer that orchestrates vertebrate tissue differentiation. Here, we

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.