Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU053851

Sigma-Aldrich

MISSION® esiRNA

targeting human PROX1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGCTCTCCTTGTCGCTCATAAAGTCCGAGTGCGGCGATCTTCAAGATATGTCTGAAATATCACCTTATTCGGGAAACTCTATGGAGGAAGGATTGTCACCCAATCACTTGAAAAAAGCAAAGCTCATGTTTTTTTATACCCGTTATCCCAGCTCCAATATGCTGAAGACCTACTTCTCCGACGTAAAGTTCAACAGATGCATTACCTCTCAGCTCATCAAGTGGTTTAGCAATTTCCGTGAGTTTTACTACATTCAGATGGAGAAGTACGCACGTCAAGCCATCAACGATGGGGTCACCAGTACTGAAGAGCTGTCTATAACCAGAGACTGTGAGCTGTACAGGGCTCTGAACATGCACTACAATAAAGCAAATGACTTTGAGGTTCCAGAGAGATTCCTGGAAGTTGCTCAGATCACATTACGGGAGTTTTTCAATGCCATTATCGCA

Ensembl | Human Hinterlegungsnummer

ENSG00000117707

NCBI-Hinterlegungsnummer

NM_002763

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... PROX1(5629) , PROX1(5629)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Toshihiko Goto et al.
FEBS letters, 591(4), 624-635 (2017-01-28)
Previous reports have revealed that Prospero-related homeobox 1 (Prox1) is required for the migration and differentiation of hepatoblasts during embryonic liver formation. However, the role of Prox1 in adults remains to be elucidated. We created liver-specific Prox1 knockout mice to
Tomonori Sasahira et al.
PloS one, 9(3), e92534-e92534 (2014-03-22)
Prospero homeobox 1 (Prox1) and forkhead box (FOX) C2 regulate angiogenesis and/or lymphangiogenesis. However, the detailed role and function of Prox1 and FOXC2 in cancer remains controversial. In the present study, we examined the expression of Prox1 and FOXC2 proteins
Kang-Jin Park et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 20(1), 104-115 (2016-01-14)
Prospero homeobox 1 (PROX1) functions as a tumor suppressor gene or an oncogene in various cancer types. However, the distinct function of PROX1 in gastric cancer is unclear. We determined whether PROX1 affected the oncogenic behavior of gastric cancer cells
Chang Rae Rho et al.
Investigative ophthalmology & visual science, 56(10), 5871-5879 (2015-09-09)
Prospero homeobox 1 (Prox1) siRNA is a small interfering RNA that is designed to specifically bind Prox1 mRNA. We determined whether Prox1 siRNA inhibits lymphangiogenesis and hemangiogenesis after acute corneal inflammation. Three Prox1 siRNAs were synthesized and investigated for their
René Hägerling et al.
The EMBO journal, 32(5), 629-644 (2013-01-10)
During mammalian development, a subpopulation of endothelial cells in the cardinal vein (CV) expresses lymphatic-specific genes and subsequently develops into the first lymphatic structures, collectively termed as lymph sacs. Budding, sprouting and ballooning of lymphatic endothelial cells (LECs) have been
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.