Direkt zum Inhalt
Merck

EHU051241

Sigma-Aldrich

MISSION® esiRNA

targeting human HMOX1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGACACCAAGGACCAGAGCCCCTCACGGGCACCAGGGCTTCGCCAGCGGGCCAGCAACAAAGTGCAAGATTCTGCCCCCGTGGAGACTCCCAGAGGGAAGCCCCCACTCAACACCCGCTCCCAGGCTCCGCTTCTCCGATGGGTCCTTACACTCAGCTTTCTGGTGGCGACAGTTGCTGTAGGGCTTTATGCCATGTGAATGCAGGCATGCTGGCTCCCAGGGCCATGAACTTTGTCCGGTGGAAGGCCTTCTTTCTAGAGAGGGAATTCTCTTGGCTGGCTTCCTTACCGTGGGCACTGAAGGCTTTCAGGGCCTCCAGCCCTCTCACTGTGTCCCTCTCTCTGGAAAGGAGGAAGGAGCCTATGGCATCTTCCCCAACGAAAAGCACATCCAGGCAAT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Kritika Sudan et al.
Free radical biology & medicine, 137, 131-142 (2019-04-27)
Heme oxygenase (HO)-1, a stress-inducible enzyme that converts heme into carbon monoxide (CO), iron and biliverdin, exerts important anti-inflammatory effects in activated macrophages. HO-1 expression is mainly governed by a mutual interplay between the transcriptional factor NRF2 and the nuclear
Yunjun Xiao et al.
Oxidative medicine and cellular longevity, 2018, 3295807-3295807 (2018-10-18)
Curcumin has several therapeutic properties such as anti-inflammatory effect. Heme oxygenase-1 (HO-1) has been showed to have cytoprotective effects in some pathological conditions. However, the role of HO-1 in anti-inflammatory effect of curcumin is unknown. In this study, we investigate
Hongyan Lu et al.
Frontiers in cell and developmental biology, 8, 584653-584653 (2020-10-27)
We have shown previously that adipose stromal cell (ASC)-derived conditioned media (CM) limited lung injury, endothelial barrier dysfunction, and apoptosis. Here, we used endothelial hyperpermeability and apoptosis assays to investigate how concentration processes affect endothelium-directed bioactivity of ASC-CM and to
Chaoying Zhu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 46(2), 644-653 (2018-04-05)
Nucleus pulposus cell (NPC) apoptosis is the main factor in intervertebral disc degeneration (IDD); thus, inhibiting the excessive apoptosis of nucleus pulposus cells may be a potential way to alleviate IDD. The effect of Hemeoxygenase-1 (HO-1) on human NPC apoptosis
Fiona C Brownfoot et al.
EBioMedicine, 41, 636-648 (2019-03-03)
Preeclampsia is a major complication of pregnancy with no medical treatment. It is associated with placental oxidative stress, hypoxia and inflammation leading to soluble fms-like tyrosine kinase 1 (sFlt-1) and soluble endoglin (sENG) secretion and reduced placental growth factor (PlGF).

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.