Direkt zum Inhalt
Merck

EHU050501

Sigma-Aldrich

MISSION® esiRNA

targeting human SGPL1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GATGACTGCTAAGGGGTGGAACTTGAACCAGTTGCAGTTCCCACCCAGTATTCATTTCTGCATCACATTACTACACGCCCGGAAACGAGTAGCTATACAATTCCTAAAGGACATTCGAGAATCTGTCACTCAAATCATGAAGAATCCTAAAGCGAAGACCACAGGAATGGGTGCCATCTATGGCATGGCCCAGACAACTGTTGACAGGAATATGGTTGCAGAATTGTCCTCAGTCTTCTTGGACAGCTTGTACAGCACCGACACTGTCACCCAGGGCAGCCAGATGAATGGTTCTCCAAAACCCCACTGAACTTGGACCCTTTCTAGTCTCAAGGGGATTCCAGCCTTCAGAAGGTTCTTGGGATATGGAACAGGCCGTGCACAACTTTGACATCTGGTCTTGCTCCATAGAGCACAACTCAAGATAGACCATGAGACAGCTTGAGCCTCAGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yuxuan Zhen et al.
Journal of autoimmunity, 93, 37-44 (2018-06-14)
Glomerulonephritis (GN) is a typical lesion in autoantibody and immune complex disorders, including SLE. Because the Gas6/Axl pathway has been implicated in the pathogenesis of many types of GN, targeting this pathway might ameliorate GN. Consequently, we have studied the
Pan-Feng Feng et al.
Molecular pharmaceutics, 16(4), 1477-1488 (2019-02-27)
The hERG potassium channel (IKr) encoded by human ether-a-go-go-related gene plays an important role in cardiac repolarization. Decreased IKr may lead to long QT syndrome, which subsequently causes torsade de pointes and sudden cardiac death. Previous studies have shown that
Haifei Wang et al.
Genes & genetic systems, 93(5), 191-198 (2018-11-27)
DNA methylation is an important mediator of gene expression regulation and has been shown to be closely linked to aging. Immune-related genes tend to be influenced by DNA methylation at different ages. To explore DNA methylation changes in the porcine
Rui Yamaguchi et al.
Cytokine, 108, 24-36 (2018-03-21)
The stimuli inducing expression of single immunoglobulin IL-1-related receptor (SIGIRR) and the relevant regulatory mechanisms are not well defined. Transforming growth factor β1 (TGFβ1) delays internalization of neurokinin-1 receptor (NK1R) and subsequently enhances cellular signaling. This study investigated the effect
Qiongying Hu et al.
Molecular medicine reports, 15(3), 1335-1342 (2017-01-19)
Osteosarcoma is the most common primary bone tumor characterized by high risk of metastasis, thus presents with an overall survival rate of 60%, despite the use of chemotherapy and surgery. Metastasis‑associated lung adenocarcinoma transcript 1 (MALAT‑1) has been reported to upregulated

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.