Direkt zum Inhalt
Merck

EHU050391

Sigma-Aldrich

MISSION® esiRNA

targeting human PIAS3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCGGACGGAATTACTCCTTGTCTGTGTACCTGGTGAGGCAGTTGACTGCAGGAACCCTTCTACAAAAACTCAGAGCAAAGGGTATCCGGAACCCAGACCACTCGCGGGCACTGATCAAGGAGAAATTGACTGCTGACCCTGACAGTGAGGTGGCCACTACAAGTCTCCGGGTGTCACTCATGTGCCCGCTAGGGAAGATGCGCCTGACTGTCCCTTGTCGTGCCCTCACCTGCGCCCACCTGCAGAGCTTCGATGCTGCCCTTTATCTACAGATGAATGAGAAGAAGCCTACATGGACATGTCCTGTGTGTGACAAGAAGGCTCCCTATGAATCTCTTATCATTGATGGTTTATTTATGGAGATTCTTAGTTCCTGTTCAGATTGTGATGAGATCCAATTCATGGAAGATGGATCCTGGTGCCCAATGAAACCCAAGAAGGAGGCATCTGAGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jeong-Hyeon Ko et al.
Immunopharmacology and immunotoxicology, 38(5), 334-343 (2016-06-22)
Constitutive activation of signal transducer and activator of transcription 3 (STAT3) is frequently observed and closely linked with proliferation, survival, metastasis and angiogenesis of various cancer cells, and thus its inhibition can be considered a potential therapeutic strategy. We found
Jordi Codony-Servat et al.
British journal of cancer, 117(12), 1777-1786 (2017-11-11)
Although chemotherapy is the cornerstone treatment for patients with metastatic colorectal cancer (mCRC), acquired chemoresistance is common and constitutes the main reason for treatment failure. Monoclonal antibodies against insulin-like growth factor-1 receptor (IGF-1R) have been tested in pre-treated mCRC patients
Jeong-Hwan Yoon et al.
Nature communications, 6, 7600-7600 (2015-07-22)
Transforming growth factor-β (TGF-β) and interleukin-6 (IL-6) are the pivotal cytokines to induce IL-17-producing CD4(+) T helper cells (TH17); yet their signalling network remains largely unknown. Here we show that the highly homologous TGF-β receptor-regulated Smads (R-Smads): Smad2 and Smad3
Xiaoyun Dai et al.
Molecular oncology, 9(4), 818-833 (2015-01-28)
Deregulated activation of oncogenic transcription factors such as signal transducer and activator of transcription 3 (STAT3) plays a pivotal role in proliferation and survival of hepatocellular carcinoma (HCC). Thus, agents which can inhibit STAT3 activation may have an enormous potential

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.