Direkt zum Inhalt
Merck

EHU048191

Sigma-Aldrich

MISSION® esiRNA

targeting human SNAI2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCGGACCCACACATTACCTTGTGTTTGCAAGATCTGCGGCAAGGCGTTTTCCAGACCCTGGTTGCTTCAAGGACACATTAGAACTCACACGGGGGAGAAGCCTTTTTCTTGCCCTCACTGCAACAGAGCATTTGCAGACAGGTCAAATCTGAGGGCTCATCTGCAGACCCATTCTGATGTAAAGAAATACCAGTGCAAAAACTGCTCCAAAACCTTCTCCAGAATGTCTCTCCTGCACAAACATGAGGAATCTGGCTGCTGTGTAGCACACTGAGTGACGCAATCAATGTTTACTCGAACAGAATGCATTTCTTCACTCCGAAGCCAAATGACAAATAAAGTCCAAAGGCATTTTCTCCTGTGCTGACCAACCAAATAATATGTATAGACACACACACATATGCACACACACACACACACACCCACAGAGAGAGAGCTGCAAGAGCATGGAATTCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Dong Hyun Jo et al.
Oncotarget, 8(9), 15441-15452 (2017-01-07)
Retinoblastoma is the most common intraocular cancer in children, affecting 1/20,000 live births. Currently, children with retinoblastoma were treated with chemotherapy using drugs such as carboplatin, vincristine, and etoposide. Unfortunately, if conventional treatment fails, the affected eyes should be removed
Adrián Blanco-Gómez et al.
Cancer research, 80(23), 5216-5230 (2020-10-08)
SNAI2 overexpression appears to be associated with poor prognosis in breast cancer, yet it remains unclear in which breast cancer subtypes this occurs. Here we show that excess SNAI2 is associated with a poor prognosis of luminal B HER2+/ERBB2+ breast
Wenyang Li et al.
Genes & development, 34(19-20), 1310-1315 (2020-09-19)
SNAI2/SLUG, a metastasis-promoting transcription factor, is a labile protein that is degraded through the ubiquitin proteasome degradation system. Here, we conducted comprehensive gain- and loss-of-function screens using a human DUB cDNA library of 65 genes and an siRNA library of
Mijung Kwon et al.
Oncotarget, 7(47), 77052-77070 (2016-10-25)
Filamin A interacting protein 1-like (FILIP1L) is an inhibitor of the canonical WNT pathway. WNT/β-catenin signaling and its downstream pathway, epithelial-to-mesenchymal transition (EMT), play a key role in ovarian cancer metastasis and chemoresistance. To study the clinical implications of FILIP1L
Carla L Alves et al.
Breast cancer research : BCR, 20(1), 60-60 (2018-06-21)
Endocrine resistance in estrogen receptor-positive (ER+) breast cancer is a major clinical problem and is associated with accelerated cancer cell growth, increased motility and acquisition of mesenchymal characteristics. However, the specific molecules and pathways involved in these altered features remain

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.