Direkt zum Inhalt
Merck

EHU044311

Sigma-Aldrich

MISSION® esiRNA

targeting human OLR1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Voraussichtliches Versanddatum13. April 2025



Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Voraussichtliches Versanddatum13. April 2025


Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAGGACCAGCCTGATGAGAAGTCAAATGGAAAAAAAGCTAAAGGTCTTCAGTTTCTTTACTCTCCATGGTGGTGCCTGGCTGCTGCGACTCTAGGGGTCCTTTGCCTGGGATTAGTAGTGACCATTATGGTGCTGGGCATGCAATTATCCCAGGTGTCTGACCTCCTAACACAAGAGCAAGCAAACCTAACTCACCAGAAAAAGAAACTGGAGGGACAGATCTCAGCCCGGCAACAAGCAGAAGAAGCTTCACAGGAGTCAGAAAACGAACTCAAGGAAATGATAGAAACCCTTGCTCGGAAGCTGAATGAGAAATCCAAAGAGCAAATGGAACTTCACCACCAGAATCTGAATCTCCAAGAAACACTGAAGAGAGTAGCAAATTGTTCAGCTCCTTGTCCGCAAGACTGGATCTGGCATGGAGAAAACTGTTACCTATTTTCCTCGGGCTCATTTAACTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Monica Villa et al.
Biochemical and biophysical research communications, 524(3), 696-701 (2020-02-09)
Inflammatory signals associated with cardiac diseases trigger trans-differentiation of cardiac fibroblasts to cardiac myofibroblasts. Cardiac myofibroblasts are the main cell type involved in the development of cardiac fibrosis, a diffuse and disproportionate accumulation of collagen in the myocardium. Although the
Baonian Liu et al.
Biochemical and biophysical research communications, 508(4), 1113-1119 (2018-12-17)
Immune responses against antigens generally require an efficient activation of antigen-presenting cells (APCs). Currently, the targeting of vaccine antigens to APCs has emerged as a promising strategy for boosting vaccine immunogenicity. Here, we reported that the C-terminus of heat shock
Tao Liu et al.
The Canadian journal of cardiology, 31(10), 1272-1281 (2015-06-23)
Lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) is a membrane protein associated with apoptosis. Endoplasmic reticulum (ER) stress-induced apoptosis has been determined in several cardiovascular diseases. Mitogen-activated protein kinase (MAPK) signalling is involved in apoptosis. The aim of this study was
Chao-Hung Chen et al.
Journal of diabetes investigation, 11(3), 535-544 (2019-10-10)
Electronegative low-density lipoprotein (L5) is the most atherogenic fraction of low-density lipoprotein and is elevated in people with metabolic syndrome (MetS), whereas the retinol-binding protein 4 receptor (stimulated by retinoic acid 6 [STRA6]) cascade is disrupted in various organs of patients with
Zufeng Ding et al.
International journal of cardiology, 184, 86-95 (2015-02-24)
Shear stress, autophagy and LOX-1 are important players in atherogenesis. Direct impact of shear stress on autophagy development in endothelial cells and role of LOX-1 therein are undelineated. A parallel-plate flow chamber was used to vary shear stress (3 to

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.