Direkt zum Inhalt
Merck

EHU043791

Sigma-Aldrich

MISSION® esiRNA

targeting human NUAK2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAAGATCGTGATCGTCATGGAGTATGCCAGCCGGGGCGACCTTTATGACTACATCAGCGAGCGGCAGCAGCTCAGTGAGCGCGAAGCTAGGCATTTCTTCCGGCAGATCGTCTCTGCCGTGCACTATTGCCATCAGAACAGAGTTGTCCACCGAGATCTCAAGCTGGAGAACATCCTCTTGGATGCCAATGGGAATATCAAGATTGCTGACTTCGGTCTCTCCAACCTCTACCATCAAGGCAAGTTCCTGCAGACATTCTGTGGGAGCCCCCTCTATGCCTCGCCAGAGATTGTCAATGGGAAGCCCTACACAGGCCCAGAGGTGGACAGCTGGTCCCTGGGTGTTCTCCTCTACATCCTGGTGCATGGCACCATGCCCTTTGATGGGCATGACCATAAGATCCTAGTGAAACAGATCAGCAACGGGGCCTACCGGGAGCCACCTAAACCCTCTGATGCCTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Devon E Mason et al.
The Journal of cell biology, 218(4), 1369-1389 (2019-02-10)
Cell migration initiates by traction generation through reciprocal actomyosin tension and focal adhesion reinforcement, but continued motility requires adaptive cytoskeletal remodeling and adhesion release. Here, we asked whether de novo gene expression contributes to this cytoskeletal feedback. We found that
Takeshi Namiki et al.
Cancer research, 75(13), 2708-2715 (2015-04-03)
The AMPK-related kinase NUAK2 has been implicated in melanoma growth and survival outcomes, but its therapeutic utility has yet to be confirmed. In this study, we show how its genetic amplification in PTEN-deficient melanomas may rationalize the use of CDK2
Mandeep K Gill et al.
Nature communications, 9(1), 3510-3510 (2018-08-31)
In most solid tumors, the Hippo pathway is inactivated through poorly understood mechanisms that result in the activation of the transcriptional regulators, YAP and TAZ. Here, we identify NUAK2 as a YAP/TAZ activator that directly inhibits LATS-mediated phosphorylation of YAP/TAZ
Martin Golkowski et al.
Cell systems, 11(2), 196-207 (2020-08-07)
Hepatocellular carcinoma (HCC) is a complex and deadly disease lacking druggable genetic mutations. The limited efficacy of systemic treatments for advanced HCC implies that predictive biomarkers and drug targets are urgently needed. Most HCC drugs target protein kinases, indicating that

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.