Direkt zum Inhalt
Merck

EHU032271

Sigma-Aldrich

MISSION® esiRNA

targeting human IKBKG

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CACTCCCTGTGAAGCTCTCCAGCATCATCGAGGTCCCATCAGGTGGGGAAAGATGCTGTTCCAGGCGCACACTAGTCTACAAGGCCAGAGCTTTCTGGAAGGGGGCACCCTTGCCCTGTTGGATGAATAGGCACCTCTGGAAGAGCCAACTGTGTGAGATGGTGCAGCCCAGTGGTGGCCCGGCAGCAGATCAGGACGTACTGGGCGAAGAGTCTCCTCTGGGGAAGCCAGCCATGCTGCACCTGCCTTCAGAACAGGGCGCTCCTGAGACCCTCCAGCGCTGCCTGGAGGAGAATCAAGAGCTCCGAGATGCCATCCGGCAGAGCAACCAGATTCTGCGGGAGCGCTGCGAGGAGCTTCTGCATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTCCTCATGTGCAAGTTCCAGGAGGCCAGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTCGATCTGAAGAGGCAGAAGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jérôme Bouchet et al.
Journal of immunology (Baltimore, Md. : 1950), 198(7), 2967-2978 (2017-02-27)
The role of endosomes in receptor signal transduction is a long-standing question, which remains largely unanswered. The T cell Ag receptor and various components of its proximal signaling machinery are associated with distinct endosomal compartments, but how endosomal traffic affects
Sona Hubackova et al.
Aging, 4(12), 932-951 (2013-02-07)
Many cancers arise at sites of infection and inflammation. Cellular senescence, a permanent state of cell cycle arrest that provides a barrier against tumorigenesis, is accompanied by elevated proinflammatory cytokines such as IL1, IL6, IL8 and TNFα. Here we demonstrate
Verena Quennet et al.
Nucleic acids research, 39(6), 2144-2152 (2010-11-20)
Topoisomerases class II (topoII) cleave and re-ligate the DNA double helix to allow the passage of an intact DNA strand through it. Chemotherapeutic drugs such as etoposide target topoII, interfere with the normal enzymatic cleavage/re-ligation reaction and create a DNA
Yu Gang Liu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(4), 5018-5033 (2019-01-01)
Cathepsin C (CtsC) functions as a central coordinator for activation of many serine proteases in immune cells. However, CtsC expression in gastric epithelial cells and its role in Helicobacter pylori infection remain unclear. Real-time PCR, Western blot, and immunohistochemistry analyses
Yun Chen et al.
PloS one, 9(5), e98483-e98483 (2014-05-24)
Previous studies showed that prostacyclin inhibited fibrosis. However, both receptors of prostacyclin, prostacyclin receptor (IP) and peroxisome proliferator-activated receptor (PPAR), are abundant in cardiac fibroblasts. Here we investigated which receptor was vital in the anti-fibrosis effect of prostacyclin. In addition

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.