Direkt zum Inhalt
Merck

EHU028201

Sigma-Aldrich

MISSION® esiRNA

targeting human NDUFA13

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Voraussichtliches Versanddatum19. April 2025



Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Voraussichtliches Versanddatum19. April 2025


Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGTCTGGGCAAAAGAGGAGTAAAGACCCCTCAGCTGCAGCCCGGCAGCGCATTCCTACCCAGGGTCCGCCGCCAGAGCTTTCCCGCGCGGTCGGATAGTTACACTACTGTCCGGGACTTCCTAGCCGTGCCGCGGACCATCTCAAGTGCTTCCGCCACACTCATCATGGCGGTGGCAGTAAGTCACTTCCGCCCGGGACCGGAAGTGTGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGCTATGGGCCCATCGACTACAAACGGAACTTGCCGCGTCGAGGACTGTCGGGCTACAGCATGCTGGCCATAGGGATTGGAACCCTGATCTACGGGCACTGGAGCATAATGAAGTGGAACCGTGAGCGCAGGCGCCTACAAATCGAGGACTTCGAGGCTCGCATCGCGCTGTTGCCACTGTTACAGGCAGAAACCGACCGGAGGACCTTGCAGATGCTTC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yi Huang et al.
Oncotarget, 7(27), 41404-41420 (2016-05-12)
Aberrant STAT3 activation occurs in most human gastric cancers (GCs) and contributes to the malignant progression of GC, but mechanism(s) underlying aberrant STAT3 remain largely unknown. Here we demonstrated that the gene associated with retinoid interferon-induced mortality 19 (GRIM-19) was
Jung-Hee Kim et al.
Frontiers in microbiology, 8, 576-576 (2017-04-27)
Gene-associated with retinoid-interferon-induced mortality 19 (GRIM-19) targets multiple signaling pathways involved in cell death and growth. However, the role of GRIM-19 in the pathogenesis of hepatitis virus infections remains unexplored. Here, we investigated the restrictive effects of GRIM-19 on the
JooYeon Jhun et al.
Cells, 10(1) (2021-01-21)
Obesity, a condition characterized by excessive accumulation of body fat, is a metabolic disorder related to an increased risk of chronic inflammation. Obesity is mediated by signal transducer and activator of transcription (STAT) 3, which is regulated by genes associated
Na Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 95, 1169-1176 (2017-09-21)
The gene associated with retinoid-interferon-induced mortality-19 (GRIM-19) has been identified as a tumor suppressor in many human cancers. However, little is known about the role of GRIM-19 in cutaneous squamous cell carcinoma (CSCC). Here, we aimed to investigate the potential
Ping Cui et al.
Cellular signalling, 71, 109598-109598 (2020-03-14)
Recent evidence has demonstrated that the signal transducer and activator of transcription 3 (STAT3) gene are abnormally active in glioblastoma multiforme (GBM), and this change is crucial for the tumor survival and chemotherapy-resistant. Certain preclinical pharmacology studies have focused on

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.