Direkt zum Inhalt
Merck

EHU021061

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX9

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51
Preise und Verfügbarkeit sind derzeit nicht verfügbar.

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATCAAGACGGAGCAGCTGAGCCCCAGCCACTACAGCGAGCAGCAGCAGCACTCGCCCCAACAGATCGCCTACAGCCCCTTCAACCTCCCACACTACAGCCCCTCCTACCCGCCCATCACCCGCTCACAGTACGACTACACCGACCACCAGAACTCCAGCTCCTACTACAGCCACGCGGCAGGCCAGGGCACCGGCCTCTACTCCACCTTCACCTACATGAACCCCGCTCAGCGCCCCATGTACACCCCCATCGCCGACACCTCTGGGGTCCCTTCCATCCCGCAGACCCACAGCCCCCAGCACTGGGAACAACCCGTCTACACACAGCTCACTCGACCTTGAGGAGGCCTCCCACGAAGGGCGAAGATGGCCGAGATGATCCTAAAAATAACCGAAGAAAGAGAGGACCAACCAGAATTCCCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Corinne Prévostel et al.
Oncotarget, 7(50), 82228-82243 (2016-07-19)
SOX9 inactivation is frequent in colorectal cancer (CRC) due to SOX9 gene mutations and/or to ectopic expression of MiniSOX9, a dominant negative inhibitor of SOX9. In the present study, we report a heterozygous L142P inactivating mutation of SOX9 in the
J-C Shang et al.
European review for medical and pharmacological sciences, 23(14), 6160-6169 (2019-08-01)
Gastric cancer is one of the most common gastrointestinal malignancy, which is often diagnosed at an advanced stage. MicroRNA-105 (miR-105) was downregulated and acts as a tumor suppressor in various cancers. The purpose of this study was to explore the
Haiyun Luo et al.
Journal of endodontics, 44(5), 792-799 (2018-03-25)
The process of pulpitis is characterized by extracellular matrix imbalance and inflammatory cell infiltration. As an essential transcription factor, sex-determining region Y-box 9 (SOX9) is significantly inhibited by tumor necrosis factor alpha in inflammatory joint diseases. The aim of this
Jing Wang et al.
Oncotarget, 8(1), 574-582 (2016-11-24)
Cisplatin-based chemotherapy is the most commonly used treatment regimen for gastric cancer (GC), however, the resistance to cisplatin represents the key limitation for the therapeutic efficacy. Aberrant expression of MiR-524-5p appears to be involves in tumorigenesis and chemoresistance. However, the
C-Q Liu et al.
European review for medical and pharmacological sciences, 23(13), 5628-5639 (2019-07-13)
The aim of the current study was to investigate the potential roles of miR-215-3p in the progression of cervical cancer. The levels of miR-215-3p in both cervical cancer tissues and cell lines were detected using quantitative Real-time polymerase chain reaction

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.