Direkt zum Inhalt
Merck

EHU020571

Sigma-Aldrich

MISSION® esiRNA

targeting human KAT2B

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCCCTAGCTGCTCATGTTTCCCACCTGGAGAATGTGTCAGAGGAAGAAATGAACAGACTCCTGGGAATAGTATTGGATGTGGAATATCTCTTTACCTGTGTCCACAAGGAAGAAGATGCAGATACCAAACAAGTTTATTTCTATCTATTTAAGCTCTTGAGAAAGTCTATTTTACAAAGAGGAAAACCTGTGGTTGAAGGCTCTTTGGAAAAGAAACCCCCATTTGAAAAACCTAGCATTGAACAGGGTGTGAATAACTTTGTGCAGTACAAATTTAGTCACCTGCCAGCAAAAGAAAGGCAAACAATAGTTGAGTTGGCAAAAATGTTCCTAAACCGCATCAACTATTGGCATCTGGAGGCACCATCTCAACGAAGACTGCGATCTCCCAATGATGATATTTCTGGATACAAAGAGAACTACACAAGGTGGCTGTGTTACTGCAACGTGCCACAGTTCTGCGACAGTCTACCTCGGTACGAAACCACACAGGTGTTTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yu-Li Jia et al.
Cell death & disease, 7(10), e2400-e2400 (2016-10-07)
Aberrant autophagic processes have been found to have fundamental roles in the pathogenesis of different kinds of tumors, including hepatocellular carcinoma (HCC). P300/CBP-associated factor (PCAF), a histone acetyltransferase (HAT), performs its function by acetylating both histone and non-histone proteins. Our
Shiladitya Sengupta et al.
DNA repair, 66-67, 1-10 (2018-04-27)
Posttranslational modifications of DNA repair proteins have been linked to their function. However, it is not clear if posttranslational acetylation affects subcellular localization of these enzymes. Here, we show that the human DNA glycosylase NEIL1, which is involved in repair
Anna Perearnau et al.
Nucleic acids research, 45(9), 5086-5099 (2017-02-06)
The cyclin-dependent kinase inhibitor p27Kip1 (p27) also behaves as a transcriptional repressor. Data showing that the p300/CBP-associated factor (PCAF) acetylates p27 inducing its degradation suggested that PCAF and p27 could collaborate in the regulation of transcription. However, this possibility remained
X Gai et al.
Cell death & disease, 6, e1712-e1712 (2015-04-10)
P300/CBP-associated factor (PCAF), a histone acetyltransferase (HAT), has been found to regulate numerous cell signaling pathways controlling cell fate by acetylating both histone and non-histone proteins. We previously reported that PCAF upregulates cell apoptosis by inactivating Serine/Threonine Protein Kinase 1
S-M Jang et al.
Cell death & disease, 6, e1857-e1857 (2015-08-21)
Transcription factor SOX4 has been implicated in skeletal myoblast differentiation through the regulation of Cald1 gene expression; however, the detailed molecular mechanism underlying this process is largely unknown. Here, we demonstrate that SOX4 acetylation at lysine 95 by KAT5 (also

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.