Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU020491

Sigma-Aldrich

MISSION® esiRNA

targeting human CFTR

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAGAATGGCCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTGGGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAACAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGATGAGGTTGGG

Ensembl | Human Hinterlegungsnummer

ENSG00000001626

NCBI-Hinterlegungsnummer

NM_000492

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CFTR(1080) , CFTR(1080)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Luiz Felipe M Prota et al.
PloS one, 7(12), e47405-e47405 (2012-12-29)
Dexamethasone is widely used for pulmonary exacerbation in patients with cystic fibrosis, however, not much is known about the effects of glucocorticoids on the wild-type cystic fibrosis channel transmembrane regulator (CFTR). Our aim was to determine the effects of dexamethasone
Babita Kaundal et al.
Journal of materials chemistry. B, 8(37), 8658-8670 (2020-08-28)
Acute myeloid leukemia (AML), which is common in the elderly population, accounts for poor long-term survival with a high possibility of relapse. The associated lack of currently developed therapeutics is directing the search for new therapeutic targets relating to AML.
Maria Favia et al.
Molecular biology of the cell, 21(1), 73-86 (2009-11-06)
We have demonstrated that Na(+)/H(+) exchanger regulatory factor 1 (NHERF1) overexpression in CFBE41o- cells induces a significant redistribution of F508del cystic fibrosis transmembrane conductance regulator (CFTR) from the cytoplasm to the apical membrane and rescues CFTR-dependent chloride secretion. Here, we
Yonghwan Shin et al.
Journal of clinical medicine, 9(3) (2020-03-19)
Cystic fibrosis transmembrane conductance regulator (CFTR), a cyclic AMP (cAMP)-regulated chloride channel, is critical for secretion and absorption across diverse epithelia. Mutations or absence of CFTR result in pathogeneses, including cancer. While CFTR has been proposed as a tumor suppressing
C Norez et al.
British journal of pharmacology, 171(21), 4831-4849 (2014-07-30)
The most common mutation in cystic fibrosis (CF), F508del, causes defects in trafficking, channel gating and endocytosis of the CF transmembrane conductance regulator (CFTR) protein. Because CF is an orphan disease, therapeutic strategies aimed at improving mutant CFTR functions are
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.