Direkt zum Inhalt
Merck

EHU002001

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAGTTGCTGGAGCTGTGAAGTTAAACCGACAACAGACTGATATGGCTGTTAATTGGGCTGGAGGATTACATCATGCTAAGAAATCAGAAGCATCAGGATTCTGTTACGTTAATGATATTGTGCTTGCCATCCTTGAATTACTAAAGTATCATCAGAGAGTCTTATATATTGATATAGATATTCATCATGGTGATGGTGTTGAAGAAGCTTTTTATACAACAGATCGTGTAATGACGGTATCATTCCATAAATATGGGGAATACTTTCCTGGCACAGGAGACTTGAGGGATATTGGTGCTGGAAAAGGCAAATACTATGCTGTCAATTTTCCAATGAGAGATGGTATAGATGATGAGTCATATGGGCAGATATTTAAGCCTATTATCTCAAAGGTGATGGAGATGTATCAACCTAGTGCTGTGGTATTACAGTGTGGTGCAGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jie Gao et al.
Gene, 678, 1-7 (2018-08-01)
Chronic diabetic foot ulcer (DFU) is a major cause of disability and mortality in patients with diabetes. Dysfunctional endothelial progenitor cells (EPCs) play important roles in preventing vascular complications in these patients. Our results determined the elevated expression of histone
Wen-Feng Fang et al.
Journal of inflammation (London, England), 15, 3-3 (2018-01-19)
Sepsis is a life-threatening organ dysfunction caused by dysregulated host response to infection, and is primarily characterized by an uncontrolled systemic inflammatory response. In the present study, we developed an effective adjunct therapy mediated by a novel mechanism, to attenuate
Ziran Wang et al.
Molecular therapy oncolytics, 17, 547-561 (2020-07-09)
Hepatocellular carcinoma (HCC) is a common malignant tumor. LukS-PV is the S component of Panton-Valetine leukocidin (PVL), which is secreted by Staphylococcus aureus. This study investigated the effects of LukS-PV on the proliferation, apoptosis, and cell-cycle progression of HCC cells
Shenglei Li et al.
Oncology letters, 13(1), 403-409 (2017-01-27)
Increasing evidence has demonstrated that histone deacetylase 2 (HDAC2) participates in the regulation of a variety of biological processes in numerous tumors. However, the potential role of HDAC2 in the development and progression of esophageal squamous cell carcinoma (ESCC) remains
David B Wang et al.
Brain pathology (Zurich, Switzerland), 29(2), 164-175 (2018-07-22)
Histone deacetylases (HDACs) catalyze acetyl group removal from histone proteins, leading to altered chromatin structure and gene expression. HDAC2 is highly expressed in adult brain, and HDAC2 levels are elevated in Alzheimer's disease (AD) brain. We previously reported that neuron-specific

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.