Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU082841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nfe2l2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGAGAACATTGTCGAGCTGGAGCAAGACTTGGGCCACTTAAAAGACGAGAGAGAAAAACTACTCAGAGAAAAGGGAGAAAACGACAGAAACCTCCATCTACTGAAAAGGCGGCTCAGCACCTTGTATCTTGAAGTCTTCAGCATGTTACGTGATGAGGATGGAAAGCCTTACTCTCCCAGTGAATACTCTCTGCAGCAAACCAGAGATGGCAATGTGTTCCTTGTTCCCAAAAGCAAGAAGCCAGATACAAAGAAAAACTAGGTTCGGGAGGATGGAGCCTTTTCTGAGCTAGTGTTTGTTTTGTACTGCTAAAACTTCCTACTGTGATGTGAAATGCAGAAACACTTTATAAGTAACTATGCAGAATTATAGCCAAAGCTAGTATAGCAATAATATGAAACTTTACAAAGCATTAAAGTCTCAATGTTGAATCAGTTTCATTTTAACTCTCAAGTTAATTTCTTAGGCACCATTTGGGAG

Numéro d'accès Ensembl | souris

ENSMUSG00000015839

Numéro d'accès NCBI

NM_010902

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... NFE2L2(18024) , Nfe2l2(18024)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Amin Haghani et al.
eLife, 9 (2020-06-25)
The neurotoxicity of air pollution is undefined for sex and APOE alleles. These major risk factors of Alzheimer's disease (AD) were examined in mice given chronic exposure to nPM, a nano-sized subfraction of urban air pollution. In the cerebral cortex
Jie Zhou et al.
PloS one, 9(7), e101668-e101668 (2014-07-06)
Salvianolic acid B (SalB), a bioactive compound isolated from the plant-derived medicinal herb Danshen, has been shown to exert various anti-oxidative and anti-inflammatory activities in several neurological disorders. In this study, we sought to investigate the potential protective effects and
Jian-ping Li et al.
Acta pharmacologica Sinica, 35(8), 1031-1044 (2014-07-01)
To investigate the anti-fibrosis effects of ginsenoside Rg1 on alcohol- and CCl4-induced hepatic fibrosis in rats and to explore the mechanisms of the effects. Rats were given 6% alcohol in water and injected with CCl4 (2 mL/kg, sc) twice a
Papavee Samatiwat et al.
Naunyn-Schmiedeberg's archives of pharmacology, 388(6), 601-612 (2015-02-25)
Resistance to chemotherapy is the major problem in cancer treatment. Cholangiocarcinoma (CCA) is the tumor arising from the bile duct epithelium. The disease is characterized by very poor prognosis and rarely responds to current radiotherapy or chemotherapy. Transcription factor Nrf2
Baixin Shen et al.
Urology, 84(4), 850-856 (2014-08-12)
To investigate the role and therapeutic potential of Nuclear factor erythroid-related factor 2 (Nrf2) in oxidative stress induced by di-N-butylphthalate (DBP) in testicular Leydig cells. Levels of reactive oxygen species (ROS) and Nrf2 in testicles from offspring of mice fed
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique