Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU224041

Sigma-Aldrich

MISSION® esiRNA

targeting human NRAS

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTTCTTTTAGCCATGTAGAAACTCTAAATTAAGCCAATATTCTCATTTGAGAATGAGGATGTCTCAGCTGAGAAACGTTTTAAATTCTCTTTATTCATAATGTTCTTTGAAGGGTTTAAAACAAGATGTTGATAAATCTAAGCTGATGAGTTTGCTCAAAACAGGAAGTTGAAATTGTTGAGACAGGAATGGAAAATATAATTAATTGATACCTATGAGGATTTGGAGGCTTGGCATTTTAATTTGCAGATAATACCCTGGTAATTCTCATGAAAAATAGACTTGGATAACTTTTGATAAAAGACTAATTCCAAAATGGCCACTTTGTTCCTGTCTTTAATATCTAAATACTTACTGAGGTCCTCCATCTTCTATATTATGAATTTTCATTTATTAAGCAAATGTCATATTACCTTGAAATTCAGAAGAGAAGAAACATATACTGTGTCCAGAGTATAATGAACCTGCAGAGTTGTGCTTCTTACTGCTAATTCTGGGAGCTTTCACAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xuemei Ji et al.
Journal of cellular biochemistry (2019-11-07)
Colorectal cancer (CRC) is a type of malignant cancer that has become particularly prevalent worldwide. It is of crucial importance to CRC treatment that the underlying molecular mechanism of CRC progression is determined. The NRAS gene is an important small
Sha Liu et al.
Cancer medicine, 6(4), 819-833 (2017-03-24)
We aimed to detect the effects of miR-145-5p on the cell proliferation, apoptosis, migration, and invasion in NRAS-mutant, BRAF-mutant, and wild-type melanoma cells, in order to figure out the potential mechanisms and provide a novel therapeutic target of melanoma. RT-qPCR
Atsuko Ogino et al.
Molecular oncology, 15(1), 27-42 (2020-03-20)
Small-cell lung cancer (SCLC) occurs infrequently in never/former light smokers. We sought to study this rare clinical subset through next-generation sequencing (NGS) and by characterizing a representative patient-derived model. We performed targeted NGS, as well as comprehensive pathological evaluation, in
Arathi Nair et al.
Cell communication and signaling : CCS, 18(1), 3-3 (2020-01-08)
Ras are small cellular GTPases which regulate diverse cellular processes. It has three isoforms: H-Ras, K-Ras, and N-Ras. Owing to the N-terminus (1-165 residues) sequence homology these isoforms were thought to be functionally redundant. However, only K-Ras-deficient mice but not
Matthew E Welsch et al.
Cell, 168(5), 878-889 (2017-02-25)
Design of small molecules that disrupt protein-protein interactions, including the interaction of RAS proteins and their effectors, may provide chemical probes and therapeutic agents. We describe here the synthesis and testing of potential small-molecule pan-RAS ligands, which were designed to interact

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique