Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU130851

Sigma-Aldrich

MISSION® esiRNA

targeting human EGF

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGCGAGAAAGGCTTATTGAGGAAGGAGTAGATGTGCCAGAAGGTCTTGCTGTGGACTGGATTGGCCGTAGATTCTATTGGACAGACAGAGGGAAATCTCTGATTGGAAGGAGTGATTTAAATGGGAAACGTTCCAAAATAATCACTAAGGAGAACATCTCTCAACCACGAGGAATTGCTGTTCATCCAATGGCCAAGAGATTATTCTGGACTGATACAGGGATTAATCCACGAATTGAAAGTTCTTCCCTCCAAGGCCTTGGCCGTCTGGTTATAGCCAGCTCTGATCTAATCTGGCCCAGTGGAATAACGATTGACTTCTTAACTGACAAGTTGTACTGGTGCGATGCCAAGCAGTCTGTGATTGAAATGGCCAATCTGGATGGTTCAAAACGCCGAAGACTTACCCAGAATGATGTAGGTCACCCATTTGCTGTAGCAGTGTTTGAGGATTATGTGTGGTTCTCAGATTGGGCTATGCCAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mingli Duan et al.
Molecular medicine reports, 18(2), 1651-1659 (2018-05-31)
Migration and invasion are the most important characteristics of human malignancies which limit cancer drug therapies in the clinic. Tongue squamous cell carcinoma (TSCC) is one of the rarest types of cancer, although it is characterized by a higher incidence
Pengfei Liu et al.
Life sciences, 230, 45-54 (2019-05-28)
The action of cell-based therapy against acute kidney injury (AKI) has been demonstrated by different groups for years. However, which kind of cells hold best therapeutic effect remains unclear. In this study, we mainly explored whether human placental trophoblast cells
Ding Zhang et al.
Clinical and translational medicine, 10(8), e231-e231 (2020-12-31)
Acute lung injury is a serious form and major cause of patient death and still needs efficient therapies. The present study evidenced that co-transplantation of mesenchymal stem cells (MSCs) and telocytes (TCs) improved the severity of experimental lung tissue inflammation
Cuijie Li et al.
Journal of cellular physiology, 236(4), 2881-2892 (2020-11-25)
Intestinal mucosal injury is one of the most significant complications of burns. In our previous study, it was found that autophagy could alleviate burn-induced intestinal injury, but the underlying mechanisms are still unclear. Irregular expression of long noncoding RNAs (lncRNAs)
Ying-Hsia Shih et al.
Oncotarget, 6(18), 16601-16610 (2015-06-13)
Colorectal adenocarcinoma is a common cause death cancer in the whole world. The aim of this study is to define the 111In-cetuximab as a diagnosis tracer of human colorectal adenocarcinoma. In this research, cell uptake, nano-SPECT/CT scintigraphy, autoradiography, biodistribution and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique