Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU068161

Sigma-Aldrich

MISSION® esiRNA

targeting human CD47

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCCTCTGGCCTCTAGGTAACCAGTTTAAATTGGTTCAGGGTGATAACTACTTAGCACTGCCCTGGTGATTACCCAGAGATATCTATGAAAACCAGTGGCTTCCATCAAACCTTTGCCAACTCAGGTTCACAGCAGCTTTGGGCAGTTATGGCAGTATGGCATTAGCTGAGAGGTGTCTGCCACTTCTGGGTCAATGGAATAATAAATTAAGTACAGGCAGGAATTTGGTTGGGAGCATCTTGTATGATCTCCGTATGATGTGATATTGATGGAGATAGTGGTCCTCATTCTTGGGGGTTGCCATTCCCACATTCCCCCTTCAACAAACAGTGTAACAGGTCCTTCCCAGATTTAGGGTACTTTTATTGATGGATATGTTTTCCTTTTATTCACATAACCCCTTGAAACCCTG

Numéro d'accès Ensembl | humain

ENSG00000196776

Numéro d'accès NCBI

NM_198793

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CD47(961) , CD47(961)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xifu Song et al.
Experimental and therapeutic medicine, 20(4), 3301-3309 (2020-08-29)
Treatment with cluster of differentiation 47 (CD47) monoclonal antibody has exhibited promising antitumor effects in various preclinical cancer models. However, its role in pancreatic ductal adenocarcinoma (PDAC) remains unclear. In the present study, the CD47 expression level was measured in
Xuejian Liu et al.
Oncology research, 27(4), 415-422 (2018-01-13)
Cluster of differentiation 47 (CD47) overexpression is common in various malignancies. This study investigated whether CD47 promotes human glioblastoma invasion and, if so, the underlying mechanisms involved. CD47 expression was found to be stronger in tissues of patients with glioblastoma
Natasha M Rogers et al.
Kidney international, 90(2), 334-347 (2016-06-05)
Defects in renal tubular epithelial cell repair contribute to renal ischemia reperfusion injury, cause acute kidney damage, and promote chronic renal disease. The matricellular protein thrombospondin-1 and its receptor CD47 are involved in experimental renal ischemia reperfusion injury, although the
Hui Zhao et al.
Scientific reports, 6, 29719-29719 (2016-07-15)
CD47 is overexpressed in many human cancers, its level positively correlates with tumor invasion and metastasis. However, it is largely unknown whether CD47 overexpression drives metastasis and how CD47 lead to tumor metastasis in non-small cell lung cancer (NSCLC). In
Jing Li et al.
Experimental cell research, 388(1), 111811-111811 (2020-01-04)
Age-related macular degeneration is a progressive ocular disease that is the leading cause of vision loss among elderly. AMD usually is divided into two types: wet and dry AMD, which is linked with inflammation. Choroidal Neovascularization (CNV) formation or wet
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique