Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU016511

Sigma-Aldrich

MISSION® esiRNA

targeting human CHN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTTACGACGCTCGTGAAAGCACATACCACTAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAGATTGAGTCTAGAGGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAATTGAAGATGTCAAGATGGCTTTCGACAGAGATGGTGAGAAGGCAGATATTTCTGTGAACATGTATGAAGATATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCAATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGATCCGGATGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTACTGCCACCTGCTCACTGCGAAACCCTCCGGTACCTCAT

Numéro d'accès Ensembl | humain

ENSG00000128656

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CHN1(1123) , CHN1(1123)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yujia Yue et al.
Tissue engineering. Part A, 23(21-22), 1241-1250 (2017-05-05)
Endothelial progenitor cell (EPC)-based therapy has immense potential to promote cardiac neovascularization and attenuate ischemic injury. Functional benefits of EPCs and other adult stem cell therapies largely involve paracrine mechanisms and exosomes secreted by stem cells are emerging as pivotal
Lei Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 1029-1035 (2016-10-22)
Due to the low cost and favorable safety profile, valproic acid (VPA) has been considered as a potential candidate drug for therapy of various cancers. Our present study revealed that VPA, at the concentration (1mM) which has no effect on
Danni Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(3-4), 644-656 (2016-11-30)
Microarray screening had found BRAF-activated non-coding RNA (BANCR) was significantly upregulated in type 1 endometrial cancer (EC). This study aimed to assess the potential role of long non-coding RNA (lncRNA) BANCR in the pathogenesis and progression of type 1 EC.
Zhuomin Wu et al.
Molecular neurobiology, 54(10), 7670-7685 (2016-11-16)
In recent years, long noncoding RNAs (lncRNAs) have been shown to have critical roles in a broad range of cell biological processes. However, the activities of lncRNAs during ischemic stroke remain largely unknown. In this study, we carried out a
Chunfeng Pan et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(1), 339-352 (2017-08-31)
Recently, long non-coding RNAs (lncRNAs) have been found to have many biological effects in different cancer stages. Several studies have revealed that focally amplified lncRNA on chromosome 1 (FAL1) regulates cancer progression via p21. However, the expression and mechanism of
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique