Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU095481

Sigma-Aldrich

MISSION® esiRNA

targeting human RIF1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGGCCACCATGAAGACTTTGCTTAGAACTTGGTCAGAATTATATAGAGCATTTGCTCGTTGTGCTGCTTTGGTGGCAACAGCAGAAGAGAACTTGTGCTGTGAGGAACTTTCTTCCAAGATAATGTCCAGTTTGGAAGATGAAGGCTTTTCTAATTTGTTGTTCGTGGATAGAATTATTTATATTATTACTGTAATGGTTGATTGCATTGACTTCTCACCATATAATATTAAATATCAGCCCAAAGTTAAATCACCACAGAGACCTTCAGATTGGTCCAAAAAGAAGAATGAGCCCCTAGGGAAA

Numéro d'accès Ensembl | humain

ENSG00000080345

Numéro d'accès NCBI

NM_018151

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... RIF1(55183) , RIF1(55183)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sylvie M Noordermeer et al.
Nature, 560(7716), 117-121 (2018-07-20)
53BP1 is a chromatin-binding protein that regulates the repair of DNA double-strand breaks by suppressing the nucleolytic resection of DNA termini1,2. This function of 53BP1 requires interactions with PTIP3 and RIF14-9, the latter of which recruits REV7 (also known as
Shin-Ichiro Hiraga et al.
EMBO reports, 18(3), 403-419 (2017-01-13)
The human RIF1 protein controls DNA replication, but the molecular mechanism is largely unknown. Here, we demonstrate that human RIF1 negatively regulates DNA replication by forming a complex with protein phosphatase 1 (PP1) that limits phosphorylation-mediated activation of the MCM
Satish Sati et al.
Molecular cell, 78(3), 522-538 (2020-03-30)
To understand the role of the extensive senescence-associated 3D genome reorganization, we generated genome-wide chromatin interaction maps, epigenome, replication-timing, whole-genome bisulfite sequencing, and gene expression profiles from cells entering replicative senescence (RS) or upon oncogene-induced senescence (OIS). We identify senescence-associated heterochromatin
Osama M Ahmed et al.
Cell reports, 27(9), 2527-2536 (2019-05-30)
Genetically wired neural mechanisms inhibit mating between species because even naive animals rarely mate with other species. These mechanisms can evolve through changes in expression or function of key genes in sensory pathways or central circuits. Gr32a is a gustatory

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique