Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU062731

Sigma-Aldrich

MISSION® esiRNA

targeting human PHF8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTCGCCATCATTCACTGTGAGGGATGTTGAACACTATGTTGGTTCTGACAAAGAGATTGATGTGATTGATGTGACCCGCCAGGCTGACTGCAAGATGAAGCTTGGTGATTTTGTGAAATACTATTACAGCGGGAAGAGGGAGAAAGTCCTCAATGTCATTAGTTTGGAATTCTCTGATACCAGACTTTCTAACCTTGTGGAGACACCGAAGATTGTTCGAAAGCTGTCATGGGTCGAAAACTTGTGGCCAGAGGAATGTGTCTTTGAGAGACCCAATGTACAGAAGTACTGCCTCATGAGTGTGCGAGATAGCTATACAGACTTTCACATTGACTTTGGTGGCACCTCTGTCTGGTACCATGTACTCAAGGGTGAAAAGATCTTCTACCTGATCCGCCCAACAAATGCCAATCTGACTCTCTTTGAGTGCTGGAGCAGTTCCTCTAATCAGAATGAGATGTTCTTTGGGGACCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ming-Zhi Cai et al.
Technology in cancer research & treatment, 19, 1533033820967472-1533033820967472 (2020-10-29)
Plant homeodomain finger protein 8 (PHF8) has been reported to participate in cancer development and metastasis of various types of tumors. However, little is known about the functional mechanism of PHF8 in gastric cancer (GC). This study aimed to explore
D Tong et al.
Oncogenesis, 5(12), e283-e283 (2016-12-20)
Recent studies provide strong evidence that the androgen receptor (AR) signaling pathway remains active in castration-resistant prostate cancer (CRPC). However, the underlying mechanisms are not well understood. In this study, we demonstrate that plant homeo domain finger protein 8 (PHF8
Peterson Kariuki Maina et al.
Oncotarget, 7(46), 75585-75602 (2016-10-01)
Epigenetic factors play critical roles in prostate cancer (PCa) development. However, how they contribute to neuroendocrine differentiation (NED) and castration-resistant PCa (CRPC) is not fully understood. Using bioinformatics and biochemical approaches to analyze cell-based models of NED and CRPC, we
Matthias S Leisegang et al.
FEBS letters, 593(5), 487-498 (2019-02-14)
Histone3-lysine9 (H3K9) residues not only control gene expression, but also contribute to RNA splicing. Here, the H3K9 histone demethylase PHF8 was investigated in endothelial cells for its involvement in alternative splicing. An angiogenic sprouting assay shows the importance of PHF8
Peterson Kariuki Maina et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1860(9), 1002-1012 (2017-07-25)
Hypoxia through transcription factor HIF1α plays a critical role in cancer development. In prostate cancer, HIF1α interplays with androgen receptor (AR) to contribute to the progression of this disease to its lethal form-castration-resistant prostate cancer (CRPC). Hypoxia upregulates several epigenetic

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique