Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU044111

Sigma-Aldrich

MISSION® esiRNA

targeting human MFN2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGATCAGGCGCCTCTCTGTACTGGTGGACGATTACCAGATGGACTTCCACCCTTCTCCAGTAGTCCTCAAGGTTTATAAGAATGAGCTGCACCGCCACATAGAGGAAGGACTGGGTCGAAACATGTCTGACCGCTGCTCCACGGCCATCACCAACTCCCTGCAGACCATGCAGCAGGACATGATAGATGGCTTGAAACCCCTCCTTCCTGTGTCTGTGCGGAGTCAGATAGACATGCTGGTCCCACGCCAGTGCTTCTCCCTCAACTATGACCTAAACTGTGACAAGCTGTGTGCTGACTTCCAGGAAGACATTGAGTTCCATTTCTCTCTCGGATGGACCATGCTGGTGAATAGGTTCCTGGGCCCCAAGAACAGCCGTCGGGCCTTGATGGGCTACAATGACCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yong Sun Lee et al.
Cancer letters, 433, 156-164 (2018-07-10)
Parkin, a critical gene of Parkinson's disease, is involved in the development of numerous cancers. However, the effect of parkin deficiency on melanoma growth and metastasis has not been reported. We showed that the tumor size and number of surface
Jihong Dong et al.
Journal of dairy science, 103(6), 5561-5574 (2020-04-13)
Inflammation is critical in the progression from benign hepatic lipidosis to pathological hepatic steatosis. The objective of this study was to examine the potential role of the outer mitochondrial membrane protein mitofusin 2 (MFN2) in the etiology of hepatic steatosis
Hongcai Cai et al.
Placenta, 70, 34-40 (2018-10-15)
Miscarriage is a common complication during pregnancy. Mitofusin-2 (MFN2) deficiency in trophoblastic cells is reported to be an important cause for early miscarriage. MFN2 can regulate mitochondrial autophagy, although the mechanisms remain unknown. This study aims to investigate the roles
Rui Zhang et al.
Molecular and cellular endocrinology, 452, 33-43 (2017-05-11)
This study was performed to investigate the oxidative stress-induced miRNA changes in relation to pathogenesis of diabetic retinopathy (DR) and to establish a functional link between miRNAs and oxidative stress-induced retinal endothelial cell injury. Our results demonstrated that oxidative stress
S Givvimani et al.
International journal of cardiology, 187, 325-333 (2015-04-05)
Mitochondria constitute 30% of cell volume and are engaged in two dynamic processes called fission and fusion, regulated by Drp-1 (dynamin related protein) and mitofusin 2 (Mfn2). Previously, we showed that Drp-1 inhibition attenuates cardiovascular dysfunction following pressure overload in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique