HSTUD0980
MISSION® Synthetic microRNA Inhibitor, Human
hsa-miR-96-5p
Sinônimo(s):
hsa-miR-96
Faça loginpara ver os preços organizacionais e de contrato
About This Item
Código UNSPSC:
12352200
NACRES:
NA.51
linha de produto
MISSION®
Formulário
solid
sequência madura
UUUGGCACUAGCACAUUUUUGCU
nº de adesão de Sanger principal/secundário
nº de adesão de microRNA de Sanger
temperatura de armazenamento
−20°C
Descrição geral
Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
Outras notas
Based on miRBase V19
Informações legais
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Palavra indicadora
Warning
Frases de perigo
Declarações de precaução
Classificações de perigo
STOT RE 2 Inhalation
Órgãos-alvo
Respiratory Tract
Código de classe de armazenamento
11 - Combustible Solids
Classe de risco de água (WGK)
WGK 3
Ponto de fulgor (°F)
Not applicable
Ponto de fulgor (°C)
Not applicable
Escolha uma das versões mais recentes:
Certificados de análise (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.
Se precisar de ajuda, entre em contato Atendimento ao cliente
Já possui este produto?
Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.
Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.
Entre em contato com a assistência técnica