Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

HSTUD0500

Sigma-Aldrich

MISSION® Synthetic microRNA Inhibitor, Human

hsa-miR-33b-5p

Sinônimo(s):

hsa-miR-33b

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
12352200
NACRES:
NA.51

linha de produto

MISSION®

Formulário

solid

sequência madura

GUGCAUUGCUGUUGCAUUGC

nº de adesão de Sanger principal/secundário

nº de adesão de microRNA de Sanger

temperatura de armazenamento

−20°C

Descrição geral

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo.[1] This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

  • Long lasting inhibition at very low dosage
  • Excellent resistance to cellular nucleases
  • Custom synthesis available for a variety of species

Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)

Outras notas

Based on miRBase V19

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Pictogramas

Health hazard

Palavra indicadora

Warning

Frases de perigo

Declarações de precaução

Classificações de perigo

STOT RE 2 Inhalation

Órgãos-alvo

Respiratory Tract

Código de classe de armazenamento

11 - Combustible Solids

Classe de risco de água (WGK)

WGK 3

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiuxing Wang et al.
Cancer research, 77(18), 4947-4960 (2017-07-22)
Metabolic dysregulation drives tumor initiation in a subset of glioblastomas harboring isocitrate dehydrogenase (IDH) mutations, but metabolic alterations in glioblastomas with wild-type IDH are poorly understood. MYC promotes metabolic reprogramming in cancer, but targeting MYC has proven notoriously challenging. Here

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica