HLTUD1491
MISSION® Lenti microRNA Inhibitor, Human
hsa-miR-4484
Sinônimo(s):
Tough Decoy, TuD
Faça loginpara ver os preços organizacionais e de contrato
About This Item
Código UNSPSC:
41106609
NACRES:
NA.51
Nível de qualidade
linha de produto
MISSION®
Formulário
liquid
concentração
≥1x106 VP/ml (via p24 assay)
técnica(s)
capture ELISA: 106 TU/mL using p24 (Volume 200 uL)
sequência madura
AAAAGGCGGGAGAAGCCCCA
nº de adesão de Sanger principal/secundário
nº de adesão de microRNA de Sanger
Condições de expedição
dry ice
temperatura de armazenamento
−70°C
Descrição geral
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.
- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Outras notas
Based on miRBase V19 Mature ID
Informações legais
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Código de classe de armazenamento
12 - Non Combustible Liquids
Classe de risco de água (WGK)
WGK 3
Ponto de fulgor (°F)
Not applicable
Ponto de fulgor (°C)
Not applicable
Escolha uma das versões mais recentes:
Certificados de análise (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.
Se precisar de ajuda, entre em contato Atendimento ao cliente
Já possui este produto?
Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.
Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.
Entre em contato com a assistência técnica