Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

HLMIR0502

Sigma-Aldrich

MISSION® Lenti microRNA, Human

hsa-miR-340-5p

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41106609
NACRES:
NA.51
Preço e disponibilidade não estão disponíveis no momento.

Nível de qualidade

linha de produto

MISSION®

Formulário

liquid

concentração

≥1x106 VP/ml (via p24 assay)

sequência madura

UUAUAAAGCAAUGAGACUGAUU

nº de adesão de Sanger principal/secundário

nº de adesão de microRNA de Sanger

Condições de expedição

dry ice

temperatura de armazenamento

−70°C

Descrição geral

Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.

Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.

Outras notas

Based on miRBase V20 Mature ID

Produtos recomendados

Two negative controls are available: NCLMIR001 and NCLMIR002

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Classe de risco de água (WGK)

WGK 3

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Kewei Du et al.
European journal of cell biology, 96(6), 496-503 (2017-08-03)
Osteogenic differentiation is regulated through multiple signaling networks that may include responses to hypoxia. Antioxidant ferulic acid (FA) can promote hypoxia signaling by inducing hypoxic-induced factor (HIF). However, whether FA could affect osteogenesis has not been explored. We examined human

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica