Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EMU208521

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Emr1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GAGTGTGATGACACATGTCCTTTGAATTCATCATGTACCAACACTATTGGGAGCTACTTCTGCACTTGCCACCCTGGCTTTGCATCTAGCAATGGACAGCTGAATTTCAAAGACCTAGAGGTGACATGTGAAGATATTGATGAGTGCACCCAAGATCCATTACAATGTGGACTGAATTCTGTCTGCACCAATGTACCAGGCTCCTACATCTGTGGCTGCCTCCCTGACTTTCAAATGGATCCAGAAGGCTCCCAAGGATATGGAAACTTCAACTGCAAAAGGATCCTCTTCAAGTGTAAGGAAGACTTGATACTCCAAAGTGAGCAGATACAGCAATGCCAAGCAGTGCAGGGCAGGGATCTTGGTTATGCTTCCTTCTGTACACTTGTGAATGCTACCTTCACAATCCTTGATAATACCTGTGAGAACAAAAGTGCCCCAGTGTCCTTACAGAGTGCAGCTACAAGTGTCTCCCTCGTGCTGGAGCAAGCGACCACATGGTTTGAGCTCAGCA

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Michael J Hansen et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 64(9), 697-706 (2015-07-08)
Adipose tissue macrophages (ATMs) have been implicated in a number of obesity-related diseases. Because the activated macrophages associated with many types of autoimmune and inflammatory diseases express a folate receptor (FR) that can be exploited for FR-targeted drug delivery, we
Takako Serizawa et al.
Infection and immunity, 84(2), 562-572 (2015-12-09)
Histopathological changes of the gastric mucosa after Helicobacter pylori infection, such as atrophy, metaplasia, and dysplasia, are considered to be precursors of gastric cancer, yet the mechanisms of histological progression are unknown. The aim of this study was to analyze
Fabiana N Soki et al.
Oncotarget, 6(34), 35782-35796 (2015-10-16)
Resident macrophages in bone play important roles in bone remodeling, repair, and hematopoietic stem cell maintenance, yet their role in skeletal metastasis remains under investigated. The purpose of this study was to determine the role of macrophages in prostate cancer
Chiyoko Sekine et al.
Arthritis & rheumatology (Hoboken, N.J.), 66(10), 2751-2761 (2014-06-20)
We previously reported that blockade of the Notch ligand delta-like protein 1 (DLL-1) suppressed osteoclastogenesis and ameliorated arthritis in a mouse model of rheumatoid arthritis (RA). However, the mechanisms by which joint inflammation were suppressed have not yet been revealed.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica