Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU196641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkcc

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCACTCCACCTTTCAGACTCCGGACCGCCTGTATTTTGTGATGGAGTATGTCACTGGGGGCGATTTAATGTACCACATCCAGCAACTGGGCAAGTTTAAGGAGCCTCATGCAGCATTCTACGCTGCGGAAATCGCCATAGGCCTCTTCTTCCTTCACAACCAGGGCATCATCTACAGGGACCTCAAGTTGGATAATGTGATGCTGGATGCTGAAGGACACATCAAGATCACAGACTTTGGCATGTGTAAAGAGAATGTCTTCCCTGGGTCCACAACCCGCACCTTCTGTGGCACCCCAGACTACATAGCACCTGAGATCATTGCCTATCAGCCCTACGGGAAGTCTGTCGACTGGTGGTCTTTTGGGGTCCTGCTGTATGAGATGTTGGCAGGACAGCCACCCTTTGATGGGGAAGATGAGGAAGAGTTGTTTCAAGCCATCATGGAACAAACTGTCACCTATCCCAAGTCACTTTCCCGGGAAGCTGTGGCCATCTGCAAAGGGTTCCTGAC

Ensembl | Número de adesão de camundongo

ENSMUSG00000078816

nº de adesão NCBI

NM_011102

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... PRKCC(18752) , Prkcc(18752)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Sergio Carracedo et al.
BMC developmental biology, 13, 16-16 (2013-05-04)
Protein kinase C epsilon (PKCϵ) belongs to the novel PKC subfamily, which consists of diacylglycerol dependent- and calcium independent-PKCs. Previous studies have shown that PKCϵ is important in different contexts, such as wound healing or cancer. In this study, we
Sergio Carracedo et al.
BMC developmental biology, 13, 2-2 (2013-01-12)
The members of the protein kinase C (PKC) family consist of serine/threonine kinases classified according to their regulatory domain. Those that belong to the novel PKC subfamily, such as PKCδ, are dependent on diacylglycerol but not Calcium when considering their
Feng Chen et al.
PloS one, 9(7), e99823-e99823 (2014-07-16)
Gram positive (G+) infections make up ∼50% of all acute lung injury cases which are characterized by extensive permeability edema secondary to disruption of endothelial cell (EC) barrier integrity. A primary cause of increased permeability are cholesterol-dependent cytolysins (CDCs) of
Imene Jaadane et al.
Journal of cellular and molecular medicine, 19(7), 1646-1655 (2015-03-18)
Light-induced retinal degeneration is characterized by photoreceptor cell death. Many studies showed that photoreceptor demise is caspase-independent. In our laboratory we showed that leucocyte elastase inhibitor/LEI-derived DNase II (LEI/L-DNase II), a caspase-independent apoptotic pathway, is responsible for photoreceptor death. In
W Miklos et al.
Cancer letters, 361(1), 112-120 (2015-03-10)
Although triapine is promising for treatment of advanced leukemia, it failed against solid tumors due to widely unknown reasons. To address this issue, a new triapine-resistant cell line (SW480/tria) was generated by drug selection and investigated in this study. Notably

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica