Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EMU182841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd68

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCTTGGGGCATATCTGTTTTGAATCCCAACAAAACCAAGGTCCAGGGAGGTTGTGACGGTACCCATCCCCACCTGTCTCTCTCATTTCCTTATGGACAGCTTACCTTTGGATTCAAACAGGACCTACATCAGAGCCCGAGTACAGTCTACCTGGACTACATGGCGGTGGAATACAATGTGTCCTTCCCACAGGCAGCACAGTGGACATTCATGGCGCAGAATTCATCTCTTCGAGAGCTCCAAGCTCCCTTGGGCCAAAGCTTCTGCTGTGGAAATGCAAGCATAGTTCTTTCTCCAGCTGTTCACCTTGACCTGCTCTCTCTAAGGCTACAGGCTGCTCAGCTGCCTGACAAGGGACACTTCGGGCCATGTTTCTCTTGCAACCGTGACCAGTCCCTCTTGCTGCCTCTCATCATTGGCCTGGTCCTCCTCGGCCTCCTCACCCTGGTGCTCATCGCCTTCTGCATCACCCGCAGACGACAATCAACCTACCAGCCCCTCTGAGCATC

Ensembl | Número de adesão de camundongo

ENSMUSG00000018774

nº de adesão NCBI

NM_009853

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... CD68(12514) , Cd68(12514)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Bao-xiang Pei et al.
The Journal of thoracic and cardiovascular surgery, 148(4), 1208-1216 (2014-06-08)
Recent experimental evidence has indicated that interstitial tumor-associated macrophages (TAMs), tumor-derived macrophage colony-stimulating factor (also known as CSF-1), and interleukin-6 (IL-6) interact in the pathogenesis of malignant epithelial tumors, including lung cancer. The present study aimed to explore their relationship
Asif Manzoor Khan et al.
Neurobiology of aging, 36(6), 2164-2175 (2015-04-22)
The susceptibility of the aging brain to neurodegenerative disease may in part be attributed to cellular aging of the microglial cells that survey it. We investigated the effect of cellular aging induced by telomere shortening on microglia by the use
Carlos Tarin et al.
Scientific reports, 5, 17135-17135 (2015-12-01)
CD163 is a membrane receptor expressed by macrophage lineage. Studies performed in atherosclerosis have shown that CD163 expression is increased at inflammatory sites, pointing at the presence of intraplaque hemorrhagic sites or asymptomatic plaques. Hence, imaging of CD163 expressing macrophages
Andrea Doni et al.
The Journal of experimental medicine, 212(6), 905-925 (2015-05-13)
Pentraxin 3 (PTX3) is a fluid-phase pattern recognition molecule and a key component of the humoral arm of innate immunity. In four different models of tissue damage in mice, PTX3 deficiency was associated with increased fibrin deposition and persistence, and

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica