Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EMU149921

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Esrrg

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTGCTCTCTGTATTCTGTGGACAGTCTTATTCTATGTACACAGATGTAATTAAAGTTGTACTCCTAACAAACAAAAGAATAGTTCAGCTTCAATGTTCCATGTTTGCTGCGCTTTTCTGAACTTTATGTTGCATTCAGAAACTGTCGTCTTGTTCTCGTGGTGTTTGGATTCTTGTGGTGTGTGCTTTTAGACACAGGGTAGAATTAGAGACAGTATTGGATGTATACTTCCTCAGGAGACTACAGTAGTATATTCTACTCCTTACCAGTAATAACTAAGAGATTGAAACTCCAAAACAGTATTCATTACGATCAGACACACATCAAAATCATAATAATATTTTCAAAAAAGGGATAATTTCTCTAATGGTTTATTATAGAATACCAATGTATAGCTTAGACATAAAACTTTGAATATTCAAGAATATAGATAAGTCTAATTTTTAAATGCTGTATATAAGGCTTCCACCTGATCATCTCTCAGATGTTGTTATTAACTCGCTCTGTGT

Ensembl | Número de adesão de camundongo

ENSMUSG00000026610

nº de adesão NCBI

NM_011935

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... ESRRG(26381) , Esrrg(26381)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jiao Meng et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 11460-11473 (2021-01-08)
Lycium barbarum berry (gouqi, Goji, goji berry, or wolfberry), a traditional medicine and functional food, has a wide range of biological effects, including immuno-modulation, anti-aging, antitumor, neuro-protection, and hepato-protection. However, thus far, little is known about the traditional effects of
Bo Yuan et al.
Cancer science, 106(7), 819-824 (2015-05-06)
Hepatocellular carcinoma (HCC) is among the leading causes of cancer-related death in China. Deregulation of microRNA (miRNA) contributes to HCC development by influencing cell growth, apoptosis, migration or invasion. It has been proved that miR-940 plays important roles in various

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica