Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EMU087911

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mef2d

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CACTCCTTCCCTGGTGACATCATCCCTTACGGACCCACGGCTCCTGTCCCCCCAGCAGCCAGCACTACAGAGAAACAGTGTTTCTCCAGGCTTGCCCCAGCGGCCTGCTAGTGCAGGAGCCATGCTGGGTGGAGACCTCAACAGTGCTAATGGAGCCTGCCCCAGCCCCGTTGGGAATGGCTATGTCAGTGCCCGAGCTTCCCCTGGCCTCCTCCCTGTGGCCAATGGCAACAGCCTAAACAAAGTCATCCCTGCCAAGTCTCCGCCCCCACCCACCCACAACACCCAGCTTGGAGCCCCCAGCCGCAAGCCTGATCTGCGGGTCATCACTTCCCAGGGAGGCAAAGGGTTAATGCATCATTTGAACAATGCCCAGCGCCTTGGGGTCTCCCAGTCTACCCACTCGCTCACCACCCCAGTGGTTTCCGTGGCAACACCAAGTTTACTCAGCCAGGGCCTCCCCTTCTCCTCCATGCCCACTGCCTACAACACAGATTACCAGCTGCCCAGTGCAGAGCTATCCTCC

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jung-Hwa Han et al.
Life sciences, 135, 1-8 (2015-06-03)
bFGF is a potent mitogen of cells associated with fibrosis. Although ERK5 has been reported to play roles in the development of fibrosis, its roles in regulating bFGF-induced fibrotic responses are not understood, especially in lung fibroblasts. The authors investigated
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica