Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU081801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Csf2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
Preço e disponibilidade não estão disponíveis no momento.

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCCTTGGAAGCATGTAGAGGCCATCAAAGAAGCCCTGAACCTCCTGGATGACATGCCTGTCACATTGAATGAAGAGGTAGAAGTCGTCTCTAACGAGTTCTCCTTCAAGAAGCTAACATGTGTGCAGACCCGCCTGAAGATATTCGAGCAGGGTCTACGGGGCAATTTCACCAAACTCAAGGGCGCCTTGAACATGACAGCCAGCTACTACCAGACATACTGCCCCCCAACTCCGGAAACGGACTGTGAAACACAAGTTACCACCTATGCGGATTTCATAGACAGCCTTAAAACCTTTCTGACTGATATCCCCTTTGAATGCAAAAAACCAGTCCAAAAATGAGGAAGCCCAGGCCAGCTCTGAATCCAGCTTCTCAGACTGCTGCTTTTGTGCCTGCGTAATGAGCCAGGAACTCGGAATTTCTGCCTTAAAGGGACCAAGAGATGTGGCACAGCCACAGTTGGAGGGCAGTAT

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Nanyan Jiang et al.
Mediators of inflammation, 2015, 601604-601604 (2015-08-11)
Enhanced expression of cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) is associated with the pathogenic processes of various tumor types. COX-2 and iNOS expression in the immunomodulatory dendritic cells is mediated by the granulocyte macrophage-colony stimulating factor (GM-CSF), which
Nathan Susnik et al.
Kidney international, 85(6), 1357-1368 (2014-01-10)
Suppressor of cytokine signaling 3 (SOCS-3) is an important intracellular negative regulator of several signaling pathways. We found that SOCS-3 is highly expressed in renal proximal tubules during acute kidney injury. To test the impact of this, conditional proximal tubular

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica