Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU074311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fermt2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCGGTTGTCCTTCATCTGTACCGAAGTAGACTGCAAGGTGGTCCACGAATTCATTGGTGGTTACATATTTCTCTCAACTCGTGCGAAAGACCAAAATGAAAGTTTAGATGAGGAGATGTTCTACAAACTCACCAGTGGTTGGGTGTGAATAGGAAAACTTGTAATAAAACTCCACAGCCATAACAATATTTAACTTTAAAGCTATTGTTTCTTATATGCTGCTTAATAAAGTAAGCTTGAACTTTATTATTTTATCATGATACCTTTTTGCCTTACCAGACCAGTACATATGTGCACTAACAAGCACGATTGTTAATCTGCTGCCTACCTTGATATGCCGTATGTGGACTGTGGAATTCCCAACAGTCCTTAGGGCCACGGAAAGCTGTCACTGACTGACAGTAACCAAACTAAGAAACAAGCCATCTACCAAGCCAC

Ensembl | Número de adesão de camundongo

ENSMUSG00000037712

nº de adesão NCBI

NP_666166

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... FERMT2(218952) , Fermt2(218952)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hai-Feng Zhang et al.
Oncotarget, 6(30), 28949-28960 (2015-09-04)
Our previous studies have shown that loss of miR-200b enhances the invasiveness of esophageal squamous cell carcinoma (ESCC) cells. However, whether the miR-200-ZEB1/2-E-cadherin regulatory cascade, a master regulator of epithelial-to-mesenchymal transition (EMT), is involved in the regulation of ESCC invasion
Yu Yu et al.
PloS one, 8(5), e63490-e63490 (2013-05-30)
Kindlin 2, as an integrin-associated protein, is required for myocyte elongation and fusion. However, the association of Kindlin 2 with muscle differentiation-related signaling pathways is unknown. Here, we identified a mechanism that Kindlin 2 regulates myogenic regulatory factors myogenin via
Zhaoli Liu et al.
FEBS letters, 589(15), 2001-2010 (2015-06-04)
Kindlin-2 regulates external to internal cell signaling by interaction with integrins in a process that involves the tyrosine kinase, Src. However, the underlying mechanisms remain elusive. Here we report that Src binds to and phosphorylates Kindlin-2 at Y193. Reciprocally, Kindlin-2-Y193

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica