Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU070971

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tmsb4x

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAGTTGAAGAAAACAGAAACGCAAGAGAAAAATCCTCTGCCTTCAAAAGAAACAATTGAACAAGAGAAGCAAGCTGGCGAATCGTAATGAGGCGAGCGCCGCCAATATGCACTGTACATTCCACGAGCATTGCCTTCTTATTTTACTTCTTTTAGCTGTTTAACTTTGTAAGATGCAAAGAGGTTGGATCAAGTTTAAATGACTGTGCTGCCCCTTTCACATCAAAGAATCAGAACTACTGAGCAGGAAGGCCTCCCCTGCCTCTCCCACCCATCTGATGGTCTGGCTAGCAGAGAGGGAAAAGAACTTGCATGTTGGTGAAGGAAAAAGCTGGGTGGGAGATGATGAAATAGAGAGGAAAATTCAACATGGTCAAAGATGTCCTGCAG

Ensembl | Número de adesão de camundongo

ENSMUSG00000049775

nº de adesão NCBI

NP_067253

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... TMSB4X(19241) , Tmsb4x(100047211)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Tamotsu Kiyoshima et al.
Stem cell research, 12(1), 309-322 (2013-12-18)
Previous studies have shown that the recombination of cells liberated from developing tooth germs develop into teeth. However, it is difficult to use human developing tooth germ as a source of cells because of ethical issues. Previous studies have reported
Bin Dong et al.
Atherosclerosis, 235(2), 449-462 (2014-06-21)
CETP inhibitors block the transfer of cholesteryl ester from HDL-C to VLDL-C and LDL-C, thereby raising HDL-C and lowering LDL-C. In this study, we explored the effect of CETP inhibitors on hepatic LDL receptor (LDLR) and PCSK9 expression and further

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica