Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU070621

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sgk3

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGGAGAGCTGCCCAAGTGTAAGCATTCCCAGCTCTGACGAACACAGAGAGAAAAAGAAGAGGTTCACGGTTTATAAAGTTCTGGTCTCTGTGGGCAGAAGCGAGTGGTTTGTCTTCAGGAGATACGCAGAGTTTGACAAACTTTACAATTCTTTAAAGAAGCAGTTTCCTGCTATGGCTCTGAAGATTCCTGCCAAGAGAATATTTGGTGATAATTTTGATCCAGATTTTATTAAACAAAGAAGAGCAGGATTGAATGAGTTCATTCAGAACTTGGTCAGATATCCAGAGCTTTACAACCATCCAGATGTCCGAGCATTCCTTCAAATGGACAGCCCAAGACATCAGTCAGATCCATCTGAAGATGAGGATGAAAGAAGTACTTCGAAGCCACATTCTACCTCACGGAACATCAACCTGGGACCAAC

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shingo Miyata et al.
Biochemical and biophysical research communications, 464(1), 76-82 (2015-06-06)
Major depression, one of the most prevalent mental illnesses, is thought to be a multifactorial disease related to both genetic and environmental factors. However, the genes responsible for and the pathogenesis of major depression at the molecular level remain unclear.
Huailei Liu et al.
Journal of neuro-oncology, 122(3), 431-439 (2015-02-28)
Glioblastoma multiforme (GBM) is the most malignant brain tumor in humans. Previous studies have demonstrated that microRNA plays important roles in the development and proliferation of GBM cells. Here we defined the mechanism by which miR-212-3p regulated the proliferation of

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica