Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU064131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Glul

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCAGGAGAAGAAGGGCTACTTTGAAGACCGTCGGCCTTCTGCCAATTGTGACCCCTATGCGGTGACAGAAGCCATCGTCCGCACGTGTCTCCTCAACGAAACAGGCGACGAACCCTTCCAATACAAGAACTAAGTGGACTAGACTTCCAGTGATCCCTCTCCCAGCTCTTCCCTTTCCCAGTTGTCCCCACTGTAACTCAAAAGGATGGAATACCAAGGTCTTTTTATTCCTCGTGCCCAGTTAATCTTGCTTTTGTTGGTCAGAATAGAGGGGTCAGGTTCTTAATCTCTACACACCAACCCTTTCTTTCCTATCTAGCTTTCTAGTGGGGAGCGGGAGGGGGGAGGGGAAGGGTAACCCACTGCTTCATCTCATCGGGTATGCATGTCCGGTAGGCATAGCTGTCACA

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Duc Dung Le et al.
Respiratory research, 15, 73-73 (2014-07-02)
A neuroimmune crosstalk between dendritic cells (DCs) and airway nerves in the lung has recently been reported. However, the presence of DCs in airway sensory ganglia under normal and allergic conditions has not been explored so far. Therefore, this study
Vitaliy Marchenko et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 308(11), R916-R926 (2015-04-03)
While supraspinal mechanisms underlying respiratory pattern formation are well characterized, the contribution of spinal circuitry to the same remains poorly understood. In this study, we tested the hypothesis that intraspinal GABAergic circuits are involved in shaping phrenic motor output. To

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica