Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU063881

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pecam1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em23 de abril de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em23 de abril de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCAGGAGTCCTTCTCCACTCCCAAGTTTGAAATCAAGCCCCCTGGGATGATCATAGAAGGGGACCAGCTGCACATTAGGTGCATAGTTCAAGTGACACACTTGGTCCAGGAGTTTACAGAAATTATCATCCAAAAAGACAAGGCGATTGTAGCCACCTCCAAGCAAAGCAGTGAAGCTGTCTACTCAGTCATGGCCATGGTCGAGTACAGTGGACACTACACCTGCAAAGTGGAATCAAACCGTATCTCCAAAGCCAGTAGCATCATGGTCAACATAACAGAGCTGTTTCCCAAGCCGAAGTTAGAGTTCTCCTCCAGTCGTCTGGACCAAGGGGAGTTGTTGGACCTGTCCTGCTCCGTCTCGGGCACACCTGTAGCCAACTTCACCATCCAGAAGGAAGAGACGG

Ensembl | Número de adesão de camundongo

ENSMUSG00000020717

nº de adesão NCBI

NM_008816

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... PECAM1(18613) , Pecam1(18613)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
AOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Masayasu Hara et al.
Anticancer research, 36(1), 169-177 (2016-01-02)
We evaluated the ability of itraconazole to enhance the effects of bevacizumab in bevacizumab-resistant cancer cells, endothelial cells, and cancer-associated fibroblasts (CAFs). Human gastrointestinal cancer cell lines (HT-29, MKN-28 and MKN-45), human umbilical vein endothelial cells (HUVECs), and CAFs established
Larissa Pfisterer et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 28(8), 3518-3527 (2014-04-29)
Despite the high prevalence of venous diseases that are associated with and based on the structural reorganization of the venous vessel wall, not much is known about their mechanistic causes. In this context, we demonstrated that the quantity of myocardin
Caroline Arnold et al.
EMBO molecular medicine, 6(8), 1075-1089 (2014-06-29)
Arteriogenesis-the growth of collateral arterioles-partially compensates for the progressive occlusion of large conductance arteries as it may occur as a consequence of coronary, cerebral or peripheral artery disease. Despite being clinically highly relevant, mechanisms driving this process remain elusive. In
James Shue-Min Yeh et al.
PloS one, 10(7), e0129681-e0129681 (2015-07-15)
Microbubbles conjugated with targeting ligands are used as contrast agents for ultrasound molecular imaging. However, they often contain immunogenic (strept)avidin, which impedes application in humans. Although targeting bubbles not employing the biotin-(strept)avidin conjugation chemistry have been explored, only a few
Yang Kyung Cho et al.
Cornea, 33(6), 621-627 (2014-04-15)
Dry eye disease is becoming recognized as an immune-inflammation mediated disorder. Surgical insults such as corneal incision or suture can aggravate dry eye. We sought to determine whether underlying dry eye aggravates corneal inflammatory infiltration, hemangiogenesis, and lymphangiogenesis (LY) induced
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica