Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU062291

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tmem131

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGTGGATATGCGTGTGAGGGATATGGTTTTAAAGTGGTTAACTGTCAAGAGTTTGCCCTGAGTGCCAACGCCTCCAGAGACATAGTCATATTGTTTACTCCAGATTTCACAGCCTCCAGAGTCATTCGGGAGCTGAAGTTTGTGACAAGCAGTGGCTCCGAGTTTGTGTTTGTGTTGAATGCCTCTCTTCCGTACCACATGCTAGCCGCCTGTGCAGAAGCCCTCCCTAGACCCAACTGGGAGCTCGCGCTCTACATCATCATCTCCGGGGTCATGAGTGCACTCTTTCTCCTGGTCATTGGAACAGCCTACTTGGAAGCTCAAGGGATTTGGGAGCCCTTCCGAAGGCGACTCTCCTTTGAAGCCTCAAACCCGCCCTTTGATGTTGGAAGGCCATTTGATCTC

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shigemi Kimura et al.
Scientific reports, 4, 5066-5066 (2014-06-12)
The ZHTc6-MyoD embryonic stem cell line expresses the myogenic transcriptional factor MyoD under the control of a tetracycline-inducible promoter. Following induction, most of the ZHTc6-MyoD cells differentiate to myotubes. However, a small fraction does not differentiate, instead forming colonies that
Yvonne Diener et al.
Scientific reports, 5, 17184-17184 (2015-11-26)
Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable
Nicholas E Hoffman et al.
Molecular biology of the cell, 25(6), 936-947 (2014-01-17)
Emerging findings suggest that two lineages of mitochondrial Ca(2+) uptake participate during active and resting states: 1) the major eukaryotic membrane potential-dependent mitochondrial Ca(2+) uniporter and 2) the evolutionarily conserved exchangers and solute carriers, which are also involved in ion

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica