Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU057231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hc

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTGGGTTTCTGAATCCTGCTACCTTCACGGTGTACGAGTATCACAGACCAGATAAGCAGTGCACCATGATTTATAGCATTTCTGACACCAGGCTTCAGAAAGTCTGTGAAGGAGCAGCTTGCACATGTGTGGAAGCTGACTGTGCGCAACTGCAGGCAGAAGTAGACCTAGCCATCTCTGCAGACTCCAGAAAAGAGAAAGCCTGTAAACCAGAGACTGCATATGCTTATAAAGTCAGGATCACATCAGCCACTGAAGAAAATGTTTTTGTCAAGTACACTGCGACTCTTCTGGTCACTTACAAAACAGGGGAAGCTGCTGATGAGAATTCGGAGGTCACCTTCATTAAAAAGATGAGCTGTACCAATGCCAACCTGGTGAAAGGGAAGCAGTATTTAATCATGGGCAAAGAGGTTCTGCAGATCAAACACAATTTCAGTTTCAAGTATATATACCCTCTAGATTCCTCCACCTGGATTGAATATTGGCCCACAGACACAACGTGTCCATCCTGTC

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Gaurav Mehta et al.
Journal of immunology (Baltimore, Md. : 1950), 194(11), 5446-5454 (2015-04-29)
Rheumatoid arthritis (RA) is an inflammatory autoimmune joint disease in which the complement system plays an important role. Of the several components of complement, current evidence points to C5 as the most important inducer of inflammation. Several groups generated Abs
Annalisa Natalicchio et al.
Diabetologia, 58(6), 1260-1271 (2015-03-27)
The role of the redox adaptor protein p66(Shc) as a potential mediator of saturated fatty acid (FA)-induced beta cell death was investigated. The effects of the FA palmitate on p66(Shc) expression were evaluated in human and murine islets and in
Xiaofei Yan et al.
Molecular and cellular biochemistry, 398(1-2), 95-104 (2014-09-14)
Excessive reactive oxygen species (ROS) generation has been implicated as one of main agents in ouabain-induced anticancer effect. Unfortunately, the signaling pathways under it are not very clarified. In the present study, we investigated the molecular mechanism involved in ouabain-induced

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica