Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU057051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Usp7

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ACCCTAAGGACCCTGCAAATTATATTCTCCATGCAGTCTTGGTTCACAGTGGAGATAATCATGGTGGACATTACGTGGTTTACCTAAACCCCAAAGGGGATGGCAAATGGTGTAAGTTCGATGATGACGTGGTATCCAGGTGTACTAAAGAAGAAGCCATTGAGCACAATTATGGGGGTCATGATGATGATCTGTCTGTTCGACACTGCACAAATGCCTATATGTTAGTGTACATCAGGGAATCAAAGCTAAGTGAAGTGTTACAAGCTGTCACCGACCATGATATTCCTCAGCAGTTGGTGGAACGATTGCAAGAAGAGAAAAGGATCGAGGCTCAGAAGCGGAAGGAGCGGCAGGAAGCCCATCTCTACATGCAAGTGCAGATAGTTGCAGAGGACCAGTTTTGTGGCCACCAAGGAAATGACATGTACGACGAGGAGAAAGTGAGGTACACTGTGTTCAAGGTTCTGAAGAACTCCTCCCTGGCCGAGTTTGTTCAGAGCCTCTCCCAG

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Serena Giovinazzi et al.
Oncotarget, 5(11), 3728-3742 (2014-07-09)
USP7 (Ubiquitin Specific processing Protease-7) is a deubiquitinase which, over the past decade emerged as a critical regulator of cellular processes. Deregulation of USP7 activity has been linked to cancer, making USP7 inhibition an appealing anti-cancer strategy. The identification of
Seemana Bhattacharya et al.
The FEBS journal, 281(13), 3061-3078 (2014-05-16)
Tumor suppressor retinoblastoma-associated protein (Rb) is an important cell cycle regulator, arresting cells in early G1. It is commonly inactivated in cancers and its level is maintained during the cell cycle. Rb is regulated by various post-translational modifications such as
Key-Hwan Lim et al.
Scientific reports, 5, 12793-12793 (2015-08-05)
HAUSP (herpes virus-associated ubiquitin specific protease, known as ubiquitin specific protease 7), one of DUBs, regulates the dynamics of the p53 and Mdm2 network in response to DNA damage by deubiquitinating both p53 and its E3 ubiquitin ligase, Mdm2. Its

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica