Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EMU055431

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fdxr

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCACCTGACCATCCTGAAGTAAAGAATGTTATCAACACATTTACACAGACAGCCCGCTCAGACCGCTGTGCCTTCCAGGGCAATGTGGTGGTGGGCAGGGACGTGTCGGTTCCAGAGCTTCGGGAAGCCTACCATGCTGTGGTGCTGAGTTATGGAGCAGAGGACCACCAACCCCTGGGAATTCCTGGCGAGGAGCTGCCTGGAGTGGTCTCAGCCCGGGCCTTTGTGGGCTGGTACAATGGACTTCCCGAGAACCAGGAGCTGGCGCCAGATCTGAGCTGTGACACGGCTGTAATTCTGGGACAGGGGAATGTGGCTCTGGATGTGGCCCGGATCCTGCTGACCCCACCTGAGCACCTGGAGAAAACAGACATCACAGAGGCTGCATTGGGGGCCCTGAGGCAGAGTCGGGTGAAGACTGTGTGGATAGTGGGCCGGCGTGGGCCCTTGCAAGTAGCGTTCACCATTAAGGAGCTTCGGGAGATGA

Ensembl | Número de adesão de camundongo

ENSMUSG00000018861

nº de adesão NCBI

NM_007997

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... FDXR(14149) , Fdxr(14149)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Tao Shan et al.
Cancer science, 105(7), 847-856 (2014-05-13)
Norepinephrine and epinephrine, catecholamine hormones that are major mediators for chronic stress-induced cancers, are implicated in the progression of a number of cancer cells, including gastric adenocarcinoma. However, the underlying mechanisms of these hormones have not been well elucidated. Epithelial-mesenchymal
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Xianwei Li et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 19(5), 401-411 (2015-09-04)
Aldose reductase (AR) is known to play a crucial role in the mediation of diabetic and cardiovascular complications. Recently, several studies have demonstrated that allergen-induced airway remodeling and ovalbumin-induced asthma is mediated by AR. Epalrestat is an aldose reductase inhibitor
Xiaolong Du et al.
Experimental biology and medicine (Maywood, N.J.), 240(11), 1472-1479 (2015-05-15)
Angiogenesis is critical to wound repair due to its role in providing oxygen and nutrients that are required to support the growth and function of reparative cells in damaged tissues. Adenosine receptors are claimed to be of paramount importance in
Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica