Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU054571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rrm1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CGCCTGAATTCTGCCATTATCTATGACCGAGATTTCTCTTATAACTACTTTGGCTTTAAGACACTGGAACGGTCATATTTGTTGAAGATCAATGGTAAAGTGGCTGAAAGACCACAGCATATGTTGATGAGGGTTTCTGTGGGGATTCACAAAGAAGATATTGATGCTGCAATTGAAACCTACAACCTACTTTCTGAGAAGTGGTTCACTCATGCCTCTCCTACTCTCTTCAATGCTGGGACCAACCGCCCACAGCTGTCTAGCTGTTTCCTCTTGAGTATGAAAGATGACAGCATTGAAGGAATTTATGATACTCTGAAGCAGTGTGCCTTGATTTCTAAGTCCGCTGGGGGAATTGGTGTTGCTGTGAGTTGTATTCGGGCCACTGGTAGCTACATCGCTGGGACTAATGGCAATTCTAATGGCCTTGTGCCAATGCTGAGAGTATATAACAACACAGCTCGCTATGTGGATCAA

Ensembl | Número de adesão de camundongo

ENSMUSG00000030978

nº de adesão NCBI

NM_009103

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... RRM1(20133) , Rrm1(20133)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jianmei Wu et al.
Journal of chromatography. B, Analytical technologies in the biomedical and life sciences, 1006, 167-178 (2015-11-10)
Simultaneous, quantitative determination of intracellular nucleoside triphosphates and other polar metabolites using liquid chromatography with electrospray ionization tandem mass spectrometry (LC-MS/MS) represents a bioanalytic challenge because of charged, highly hydrophilic analytes presented at a large concentration range in a complex
Rong Yao et al.
PloS one, 10(5), e0125169-e0125169 (2015-05-07)
Pulmonary fibrosis is one of the most common complications of paraquat (PQ) poisoning, which demands for more effective therapies. Accumulating evidence suggests adiponectin (APN) may be a promising therapy against fibrotic diseases. In the current study, we determine whether the
Chou-Kit Chou et al.
International journal of molecular sciences, 16(7), 15104-15117 (2015-07-08)
BubR1 is a critical component of spindle assembly checkpoint, ensuring proper chromatin segregation during mitosis. Recent studies showed that BubR1 was overexpressed in many cancer cells, including oral squamous cell carcinomas (OSCC). However, the effect of BubR1 on metastasis of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica